ID: 1120690892

View in Genome Browser
Species Human (GRCh38)
Location 14:87591059-87591081
Sequence ATGAGGAAGGAAAATGAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120690885_1120690892 23 Left 1120690885 14:87591013-87591035 CCCAGGGAAAAGAAACTAGAAAG No data
Right 1120690892 14:87591059-87591081 ATGAGGAAGGAAAATGAGGATGG No data
1120690886_1120690892 22 Left 1120690886 14:87591014-87591036 CCAGGGAAAAGAAACTAGAAAGT No data
Right 1120690892 14:87591059-87591081 ATGAGGAAGGAAAATGAGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120690892 Original CRISPR ATGAGGAAGGAAAATGAGGA TGG Intergenic
No off target data available for this crispr