ID: 1120695942

View in Genome Browser
Species Human (GRCh38)
Location 14:87645223-87645245
Sequence CAGAGTATACCTATGGATGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120695942_1120695945 3 Left 1120695942 14:87645223-87645245 CCACCATCCATAGGTATACTCTG No data
Right 1120695945 14:87645249-87645271 GTGTGTATGTGTGTATAGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120695942 Original CRISPR CAGAGTATACCTATGGATGG TGG (reversed) Intergenic
No off target data available for this crispr