ID: 1120695945

View in Genome Browser
Species Human (GRCh38)
Location 14:87645249-87645271
Sequence GTGTGTATGTGTGTATAGTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120695944_1120695945 -4 Left 1120695944 14:87645230-87645252 CCATAGGTATACTCTGTATGTGT No data
Right 1120695945 14:87645249-87645271 GTGTGTATGTGTGTATAGTGAGG No data
1120695942_1120695945 3 Left 1120695942 14:87645223-87645245 CCACCATCCATAGGTATACTCTG No data
Right 1120695945 14:87645249-87645271 GTGTGTATGTGTGTATAGTGAGG No data
1120695943_1120695945 0 Left 1120695943 14:87645226-87645248 CCATCCATAGGTATACTCTGTAT No data
Right 1120695945 14:87645249-87645271 GTGTGTATGTGTGTATAGTGAGG No data
1120695941_1120695945 6 Left 1120695941 14:87645220-87645242 CCACCACCATCCATAGGTATACT No data
Right 1120695945 14:87645249-87645271 GTGTGTATGTGTGTATAGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120695945 Original CRISPR GTGTGTATGTGTGTATAGTG AGG Intergenic
No off target data available for this crispr