ID: 1120697498

View in Genome Browser
Species Human (GRCh38)
Location 14:87660059-87660081
Sequence CTGTGGTGGTGGTGGTCACA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120697489_1120697498 -1 Left 1120697489 14:87660037-87660059 CCTGGCAGTACTCCCCATGGGCC 0: 15
1: 48
2: 149
3: 264
4: 500
Right 1120697498 14:87660059-87660081 CTGTGGTGGTGGTGGTCACAAGG No data
1120697482_1120697498 29 Left 1120697482 14:87660007-87660029 CCCTGGGCTTTAAGTGAACATCA 0: 18
1: 57
2: 157
3: 354
4: 660
Right 1120697498 14:87660059-87660081 CTGTGGTGGTGGTGGTCACAAGG No data
1120697481_1120697498 30 Left 1120697481 14:87660006-87660028 CCCCTGGGCTTTAAGTGAACATC 0: 2
1: 25
2: 86
3: 232
4: 598
Right 1120697498 14:87660059-87660081 CTGTGGTGGTGGTGGTCACAAGG No data
1120697483_1120697498 28 Left 1120697483 14:87660008-87660030 CCTGGGCTTTAAGTGAACATCAG 0: 3
1: 4
2: 21
3: 55
4: 256
Right 1120697498 14:87660059-87660081 CTGTGGTGGTGGTGGTCACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120697498 Original CRISPR CTGTGGTGGTGGTGGTCACA AGG Intergenic
No off target data available for this crispr