ID: 1120700272

View in Genome Browser
Species Human (GRCh38)
Location 14:87691462-87691484
Sequence CTCTATACACATAGTGAGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120700269_1120700272 -2 Left 1120700269 14:87691441-87691463 CCTCTCAAGGAGACCGGGCTCCT No data
Right 1120700272 14:87691462-87691484 CTCTATACACATAGTGAGCAAGG No data
1120700268_1120700272 -1 Left 1120700268 14:87691440-87691462 CCCTCTCAAGGAGACCGGGCTCC No data
Right 1120700272 14:87691462-87691484 CTCTATACACATAGTGAGCAAGG No data
1120700267_1120700272 0 Left 1120700267 14:87691439-87691461 CCCCTCTCAAGGAGACCGGGCTC No data
Right 1120700272 14:87691462-87691484 CTCTATACACATAGTGAGCAAGG No data
1120700262_1120700272 5 Left 1120700262 14:87691434-87691456 CCCTCCCCCTCTCAAGGAGACCG No data
Right 1120700272 14:87691462-87691484 CTCTATACACATAGTGAGCAAGG No data
1120700263_1120700272 4 Left 1120700263 14:87691435-87691457 CCTCCCCCTCTCAAGGAGACCGG No data
Right 1120700272 14:87691462-87691484 CTCTATACACATAGTGAGCAAGG No data
1120700258_1120700272 17 Left 1120700258 14:87691422-87691444 CCATTTTCCCTTCCCTCCCCCTC No data
Right 1120700272 14:87691462-87691484 CTCTATACACATAGTGAGCAAGG No data
1120700261_1120700272 9 Left 1120700261 14:87691430-87691452 CCTTCCCTCCCCCTCTCAAGGAG No data
Right 1120700272 14:87691462-87691484 CTCTATACACATAGTGAGCAAGG No data
1120700260_1120700272 10 Left 1120700260 14:87691429-87691451 CCCTTCCCTCCCCCTCTCAAGGA No data
Right 1120700272 14:87691462-87691484 CTCTATACACATAGTGAGCAAGG No data
1120700266_1120700272 1 Left 1120700266 14:87691438-87691460 CCCCCTCTCAAGGAGACCGGGCT No data
Right 1120700272 14:87691462-87691484 CTCTATACACATAGTGAGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120700272 Original CRISPR CTCTATACACATAGTGAGCA AGG Intergenic
No off target data available for this crispr