ID: 1120702692

View in Genome Browser
Species Human (GRCh38)
Location 14:87715225-87715247
Sequence CCCTTCCAGTCGAAGAGCTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120702686_1120702692 27 Left 1120702686 14:87715175-87715197 CCTATAAATTCTCATAACCAATT No data
Right 1120702692 14:87715225-87715247 CCCTTCCAGTCGAAGAGCTGGGG No data
1120702685_1120702692 28 Left 1120702685 14:87715174-87715196 CCCTATAAATTCTCATAACCAAT No data
Right 1120702692 14:87715225-87715247 CCCTTCCAGTCGAAGAGCTGGGG No data
1120702687_1120702692 10 Left 1120702687 14:87715192-87715214 CCAATTAAGAGAAAGTCATAGAA No data
Right 1120702692 14:87715225-87715247 CCCTTCCAGTCGAAGAGCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120702692 Original CRISPR CCCTTCCAGTCGAAGAGCTG GGG Intergenic
No off target data available for this crispr