ID: 1120706191

View in Genome Browser
Species Human (GRCh38)
Location 14:87748297-87748319
Sequence CTGGCTAATGAGATGGTGTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120706191_1120706195 1 Left 1120706191 14:87748297-87748319 CCTTACACCATCTCATTAGCCAG No data
Right 1120706195 14:87748321-87748343 ATGGCCAAATCAAGTTGTAATGG No data
1120706191_1120706197 8 Left 1120706191 14:87748297-87748319 CCTTACACCATCTCATTAGCCAG No data
Right 1120706197 14:87748328-87748350 AATCAAGTTGTAATGGAGTCTGG No data
1120706191_1120706199 25 Left 1120706191 14:87748297-87748319 CCTTACACCATCTCATTAGCCAG No data
Right 1120706199 14:87748345-87748367 GTCTGGGAAATATATATCTCAGG No data
1120706191_1120706198 9 Left 1120706191 14:87748297-87748319 CCTTACACCATCTCATTAGCCAG No data
Right 1120706198 14:87748329-87748351 ATCAAGTTGTAATGGAGTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120706191 Original CRISPR CTGGCTAATGAGATGGTGTA AGG (reversed) Intergenic
No off target data available for this crispr