ID: 1120708509

View in Genome Browser
Species Human (GRCh38)
Location 14:87769545-87769567
Sequence TTAGTCCTGCCCTTCACACG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120708505_1120708509 0 Left 1120708505 14:87769522-87769544 CCTAATAATCCAGTTACCTCCAC No data
Right 1120708509 14:87769545-87769567 TTAGTCCTGCCCTTCACACGTGG No data
1120708506_1120708509 -9 Left 1120708506 14:87769531-87769553 CCAGTTACCTCCACTTAGTCCTG No data
Right 1120708509 14:87769545-87769567 TTAGTCCTGCCCTTCACACGTGG No data
1120708504_1120708509 1 Left 1120708504 14:87769521-87769543 CCCTAATAATCCAGTTACCTCCA No data
Right 1120708509 14:87769545-87769567 TTAGTCCTGCCCTTCACACGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120708509 Original CRISPR TTAGTCCTGCCCTTCACACG TGG Intergenic
No off target data available for this crispr