ID: 1120711507

View in Genome Browser
Species Human (GRCh38)
Location 14:87797929-87797951
Sequence TATTGGTGCTGAGTCCTGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120711503_1120711507 3 Left 1120711503 14:87797903-87797925 CCCAGTCTCTGGTGCAAAAGAAT No data
Right 1120711507 14:87797929-87797951 TATTGGTGCTGAGTCCTGCAGGG No data
1120711501_1120711507 18 Left 1120711501 14:87797888-87797910 CCACTGACTCTGACACCCAGTCT No data
Right 1120711507 14:87797929-87797951 TATTGGTGCTGAGTCCTGCAGGG No data
1120711504_1120711507 2 Left 1120711504 14:87797904-87797926 CCAGTCTCTGGTGCAAAAGAATG No data
Right 1120711507 14:87797929-87797951 TATTGGTGCTGAGTCCTGCAGGG No data
1120711500_1120711507 19 Left 1120711500 14:87797887-87797909 CCCACTGACTCTGACACCCAGTC No data
Right 1120711507 14:87797929-87797951 TATTGGTGCTGAGTCCTGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120711507 Original CRISPR TATTGGTGCTGAGTCCTGCA GGG Intergenic
No off target data available for this crispr