ID: 1120722278

View in Genome Browser
Species Human (GRCh38)
Location 14:87902115-87902137
Sequence CTCATTCATCACTACCATTT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 201
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 182}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120722275_1120722278 -9 Left 1120722275 14:87902101-87902123 CCACTTTTTACCACCTCATTCAT 0: 1
1: 1
2: 2
3: 36
4: 335
Right 1120722278 14:87902115-87902137 CTCATTCATCACTACCATTTTGG 0: 1
1: 0
2: 1
3: 17
4: 182
1120722272_1120722278 30 Left 1120722272 14:87902062-87902084 CCTGCTGGTTCTACCATCTAAAC 0: 1
1: 0
2: 1
3: 15
4: 150
Right 1120722278 14:87902115-87902137 CTCATTCATCACTACCATTTTGG 0: 1
1: 0
2: 1
3: 17
4: 182
1120722273_1120722278 17 Left 1120722273 14:87902075-87902097 CCATCTAAACTGTATCTAGAATC 0: 1
1: 0
2: 0
3: 19
4: 173
Right 1120722278 14:87902115-87902137 CTCATTCATCACTACCATTTTGG 0: 1
1: 0
2: 1
3: 17
4: 182
1120722274_1120722278 -5 Left 1120722274 14:87902097-87902119 CCAACCACTTTTTACCACCTCAT 0: 1
1: 0
2: 4
3: 51
4: 272
Right 1120722278 14:87902115-87902137 CTCATTCATCACTACCATTTTGG 0: 1
1: 0
2: 1
3: 17
4: 182

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120722278 Original CRISPR CTCATTCATCACTACCATTT TGG Intronic
907368004 1:53978701-53978723 CTCAGGCATCACTATCTTTTGGG - Intergenic
911791731 1:102025603-102025625 CTCAAATATTACTACCATTTTGG - Intergenic
912907408 1:113721145-113721167 ATCATTCATCACGACCAAGTAGG + Intronic
913166695 1:116193913-116193935 CACATTCAAAACTTCCATTTAGG - Intergenic
916157022 1:161862274-161862296 CTCATTTATTACTTCCATTTAGG + Intronic
916696870 1:167246805-167246827 CTCATTTAACAGTTCCATTTAGG - Intronic
917375284 1:174346093-174346115 ATCATTCATCATGACCAATTGGG - Intronic
918947455 1:191086375-191086397 GTCATTCATCATAACCAGTTGGG + Intergenic
920973989 1:210768560-210768582 CTTTCCCATCACTACCATTTGGG + Intronic
923544772 1:234916177-234916199 CTCTTTCAACACTTCTATTTCGG - Intergenic
1064858210 10:19795663-19795685 CTCATTCATCATTAACATTCGGG + Intergenic
1065166498 10:22984735-22984757 CTCATTCATGAATACCAAATGGG - Intronic
1066551993 10:36568789-36568811 TTCATTCATCAATACCCTTAAGG + Intergenic
1068353916 10:55885563-55885585 CTTATCCATCACGATCATTTAGG + Intergenic
1071063827 10:81606808-81606830 CTCATTCATCCTTACATTTTGGG + Intergenic
1071108982 10:82132385-82132407 ATCATTCATCATGACCACTTGGG - Intronic
1071854614 10:89611135-89611157 TTCATTAATGAATACCATTTAGG - Intronic
1072059210 10:91792764-91792786 CTCATTCATCATGACCAAGTGGG + Intergenic
1072171504 10:92867317-92867339 CTCAATCATTGCTGCCATTTAGG + Intronic
1072396870 10:95052587-95052609 CTCACTCATCACAACCAAGTGGG + Intronic
1076456538 10:130603732-130603754 ATCATTCATCACGACCAAGTGGG - Intergenic
1078135247 11:8646486-8646508 CTCATTCATCAGAACCATCTTGG + Exonic
1078555781 11:12324998-12325020 CTCTCTCATCACAACCATCTGGG - Intronic
1078797023 11:14602324-14602346 CTCATTTATCACCACCTCTTTGG + Intronic
1080265963 11:30402118-30402140 CCCCTTCATCACCACCACTTTGG - Intronic
1082709004 11:56529881-56529903 CTAATTCATCACCATCACTTGGG - Intergenic
1083588552 11:63878259-63878281 CTCATTCCTCATCTCCATTTGGG + Intronic
1086172259 11:83850097-83850119 TTCATTCATCCGTAACATTTGGG + Intronic
1087080272 11:94163573-94163595 ATCATTCATCACAACCAAGTGGG - Intronic
1087767598 11:102173103-102173125 CACTTTCATCACCACCACTTTGG - Intronic
1087970920 11:104482267-104482289 ATCATTGATCACTACCAAGTGGG + Intergenic
1088421885 11:109657548-109657570 ATCATTTATCACTTCCATTTAGG - Intergenic
1092581165 12:9843638-9843660 TCCATTCATCACTACCCGTTAGG + Intronic
1093618366 12:21256213-21256235 TTCATTCATCACTAGCCATTTGG + Intergenic
1094581467 12:31737644-31737666 CTCCTACCTCAATACCATTTGGG + Intergenic
1096450160 12:51733403-51733425 ATCATTCATCATTACCAAGTTGG - Intronic
1096550185 12:52367108-52367130 CCCATGCATCACTACCGTGTCGG - Exonic
1097889529 12:64763572-64763594 CTCATTCATCTTTATCACTTTGG + Intergenic
1098705941 12:73689441-73689463 ATCATTCATCATGACCATGTGGG + Intergenic
1099341172 12:81436889-81436911 CTCATTATTAACTTCCATTTTGG - Intronic
1100583604 12:95959146-95959168 CTCACTCAGCAAAACCATTTGGG - Intronic
1101459281 12:104873421-104873443 CTCATCCATCAGGAACATTTAGG + Intronic
1104793797 12:131501695-131501717 CTCATTCATCAGGTCTATTTTGG - Intergenic
1107211200 13:37856673-37856695 GTCATTCATCATGACCATGTTGG + Intronic
1109336259 13:60998794-60998816 ATCATTCATCATGACCAATTGGG - Intergenic
1111597055 13:90425782-90425804 CTAATTCATCCATACTATTTTGG + Intergenic
1112843155 13:103605501-103605523 ATAATTCATCACAACCATGTGGG + Intergenic
1112961517 13:105133073-105133095 CTGATTCATCACTAATATCTCGG - Intergenic
1115947613 14:38679913-38679935 CTCATTGATCACTGGCAATTAGG + Intergenic
1118262448 14:64260192-64260214 CTCTTTCTGCACTACCATGTTGG + Intronic
1120672541 14:87379590-87379612 GTGATTCATCAATACCAATTTGG - Intergenic
1120722278 14:87902115-87902137 CTCATTCATCACTACCATTTTGG + Intronic
1122230183 14:100303075-100303097 TTCTTTCATGACTTCCATTTGGG + Intronic
1125037130 15:35138060-35138082 CTCATTCATCAAAGCCATATAGG + Intergenic
1127780607 15:62310931-62310953 TTCATTCATCATGACCATGTGGG + Intergenic
1130867610 15:87945770-87945792 CTCTTTCAGCAGTGCCATTTGGG - Intronic
1139053798 16:63157124-63157146 CGCATTCATCACTTTCAGTTTGG - Intergenic
1146168829 17:30616556-30616578 TTCATTCATCTCTAATATTTTGG + Intergenic
1146170734 17:30630892-30630914 TTCATTCATCTCTAATATTTTGG - Intergenic
1146188069 17:30738830-30738852 CTAATTCATCACCTCCTTTTTGG - Intergenic
1146344182 17:32046911-32046933 TTCATTCATCTCTAATATTTTGG - Intronic
1149666006 17:58365096-58365118 CTCCTTCAGCACTTCCATTCTGG - Intronic
1150952568 17:69820339-69820361 CTTATTCATTCCTACCTTTTTGG + Intergenic
1152909721 17:82994831-82994853 ATCATTCATCACGACCAAGTGGG + Intronic
1153132474 18:1871732-1871754 CACACTCATCACTAGCATGTCGG + Intergenic
1155818131 18:30342259-30342281 CTAAATAATCACTACCATTATGG - Intergenic
1158565181 18:58549037-58549059 CTTATTCATCACTAATAGTTTGG + Intronic
1158694118 18:59688169-59688191 CTAATTCAAAACTAACATTTCGG + Intronic
1158769408 18:60496321-60496343 CTCCTTCACCTCTGCCATTTTGG + Intergenic
1164517912 19:28951939-28951961 CTCATTGATCAATTCCATCTCGG - Intergenic
1166730202 19:45054955-45054977 CTCAGTGATCACTAGAATTTTGG - Intronic
1167023928 19:46900627-46900649 CTAATTCATTAATTCCATTTAGG + Intergenic
1167526518 19:49987653-49987675 CTCATTCATCACAAACATGCAGG - Intronic
929596260 2:43178267-43178289 TTCATTCATCAAAACCATGTTGG - Intergenic
934991479 2:98924806-98924828 CTCATTCAGCACCCCCTTTTTGG - Intronic
942314642 2:174686383-174686405 CCATTTCATAACTACCATTTTGG + Intergenic
942698364 2:178673827-178673849 CACATTTATTATTACCATTTAGG - Intronic
943372555 2:187032836-187032858 TTCATTCAACACTGACATTTTGG + Intergenic
944352989 2:198751884-198751906 ATCAGTCTTCCCTACCATTTTGG + Intergenic
944591473 2:201221705-201221727 CTCCTTCATCAGGAGCATTTGGG + Intronic
945712804 2:213320925-213320947 ATGATTAAACACTACCATTTGGG - Intronic
946701301 2:222417022-222417044 CTCATTCACCACTAGAAGTTAGG - Intergenic
947130643 2:226920728-226920750 ATCATTCATTATGACCATTTGGG - Intronic
1168916816 20:1495630-1495652 CTCATTCATCATGACCAAGTGGG - Intergenic
1169258309 20:4116055-4116077 CTCATTTATGTCAACCATTTGGG + Intergenic
1171432939 20:25096813-25096835 TTCTTTCATGAATACCATTTTGG - Intergenic
1171851197 20:30309379-30309401 ATCTTTAATGACTACCATTTAGG - Intergenic
1174060876 20:47832331-47832353 TGCATTCATCACTAGCATTGAGG + Intergenic
1174071022 20:47899039-47899061 TGCATTCATCACTAGCATTGAGG - Intergenic
1175353299 20:58341857-58341879 CACATCCAACACTTCCATTTTGG - Intronic
1176104657 20:63380293-63380315 CTCTTTCAGCCCTGCCATTTGGG - Intergenic
1176772130 21:13085712-13085734 TTATTTCATCACAACCATTTTGG - Intergenic
1179333481 21:40427921-40427943 CTGATTAATCAGTATCATTTGGG - Intronic
1181095445 22:20501984-20502006 CTGACTCACGACTACCATTTTGG + Intronic
1182960910 22:34474408-34474430 CTCCTTCATCTCTAACATTAAGG - Intergenic
1183996679 22:41639096-41639118 CTCATGCACCACTAACATTTTGG - Intronic
1184963981 22:47953478-47953500 CTCACTCAACTCTACCATTTGGG + Intergenic
950274179 3:11644262-11644284 CTTATGCATCACTAGCACTTTGG - Intronic
952158525 3:30669892-30669914 CTCCTTTATCAGTATCATTTAGG + Intronic
953486470 3:43302314-43302336 CTCTTGCATCACTACTGTTTAGG - Intronic
956661979 3:71608050-71608072 CTCATTCTTCCCTACCATTTTGG + Intergenic
957622278 3:82609154-82609176 ATCATTCATCACCACCAATTGGG + Intergenic
959042204 3:101435062-101435084 CTCATTCATCATAACCATGTGGG + Intronic
959804460 3:110534204-110534226 ATCATCCATCACTACCAAGTGGG + Intergenic
959974263 3:112440377-112440399 CTTATTCATCACTATCAAGTAGG + Intergenic
960296761 3:115954210-115954232 CTCATTCATCTCTGGCATATGGG + Intronic
960729972 3:120716387-120716409 CTCAGTAATTACTAACATTTTGG - Intronic
961579673 3:127870215-127870237 CTCTTTCTTCACTTCCAATTTGG - Intergenic
962146243 3:132842983-132843005 CTCAATCATCACTACCACCGGGG - Intergenic
962751574 3:138437720-138437742 CTCCCTCATTACTACCATCTTGG - Intronic
963722776 3:148882732-148882754 GACAATCATCACTACCATTGAGG + Intronic
964474711 3:157088439-157088461 CTCATTTATTTTTACCATTTAGG + Intergenic
964975901 3:162620233-162620255 ATCATTCATCACGACCAAGTGGG - Intergenic
968109318 3:196030455-196030477 ATCATTCATCACGACCAAGTGGG + Intronic
969296183 4:6271642-6271664 TTCATTCCTCACTCCCAGTTGGG + Intronic
970864419 4:20742359-20742381 CTTATCCACCACTATCATTTTGG + Intronic
972512456 4:39782131-39782153 CACATTCAAGACTTCCATTTAGG - Exonic
972770322 4:42191629-42191651 CTAATCCATCACGAACATTTTGG + Intergenic
973214713 4:47656129-47656151 GTCATTCATCATGACCATTTAGG + Intronic
973660030 4:53095443-53095465 CTCCTTCACCACTACCATCCTGG + Intronic
979883690 4:125996215-125996237 CTCATTCAGCACAACCATGCTGG - Intergenic
980102596 4:128556541-128556563 CTCATTCACCTCTTTCATTTTGG + Intergenic
981213942 4:142140424-142140446 CTGGTTAATCACTACCCTTTGGG - Intronic
981447977 4:144862390-144862412 GTCATGCATCACTTCCATCTCGG - Intergenic
981889284 4:149716362-149716384 CTCAGTCCTCACTCCAATTTTGG - Intergenic
982120063 4:152134510-152134532 CTCATCCCCCACTCCCATTTTGG - Intergenic
982344829 4:154345715-154345737 CTCATTCACCACTACCAAACAGG + Intronic
982541983 4:156684349-156684371 ATAATCCATCACTACCAGTTAGG - Intergenic
983620531 4:169757116-169757138 CTCATACTTTACTACGATTTCGG - Intronic
983646775 4:169999582-169999604 CACATTAATCACTTCCATTTTGG + Intronic
986113549 5:4746696-4746718 CTAATACATCATTACCATGTGGG - Intergenic
986535503 5:8782774-8782796 CTCATTGTTCACTCCCACTTAGG + Intergenic
986849615 5:11795722-11795744 CTCATACATGAATAACATTTTGG - Intronic
987031517 5:13980610-13980632 CTCATCCACCACTACCACTCTGG + Intergenic
987535566 5:19183638-19183660 CTCATGCAACTCTTCCATTTGGG - Intergenic
988079940 5:26402346-26402368 CCCATTCACCTCTCCCATTTGGG - Intergenic
989313545 5:40050016-40050038 ATCATTCATCAGTATCATATGGG - Intergenic
992583741 5:78210248-78210270 CTCAATAATCTCTAACATTTTGG + Intronic
995171682 5:109121444-109121466 ATCATTCATCACGACCAAGTGGG - Intronic
995384409 5:111573085-111573107 CCCATTAATCTCTACCTTTTGGG + Intergenic
995713931 5:115063089-115063111 CTTTTTCATCACTGCCCTTTTGG - Intergenic
997039831 5:130239692-130239714 CTCATTGATCACTGCCTTTAAGG + Intergenic
997085940 5:130798662-130798684 TTCTTTCATCTCTACCTTTTAGG + Intergenic
998783840 5:145687668-145687690 CTTATGCATCACTAGCATTTAGG + Intronic
1002405795 5:179029502-179029524 CTCATTTATAGCTACCATTCTGG - Intronic
1004627344 6:17389395-17389417 CTCATTCATCAGAATCATCTGGG - Intergenic
1004908363 6:20258650-20258672 CTCATCCTTCGCAACCATTTGGG - Intergenic
1010054391 6:71547667-71547689 CTCAATCATCACAACAATTTTGG - Intergenic
1010322073 6:74523083-74523105 GTCATTCATCACAACCAAGTGGG - Intergenic
1012504021 6:99923768-99923790 CTCATTCATCATGACCAAGTGGG - Intronic
1013532966 6:111036939-111036961 ATCATTCATCAATATCCTTTGGG - Intergenic
1014331442 6:120070340-120070362 ATCATTCATCACGACCAAATTGG - Intergenic
1014558974 6:122867801-122867823 CTCATTCCTCAGTACAATATGGG + Intergenic
1016885518 6:148956173-148956195 CTCAGTCATCCCTACCATATAGG + Intronic
1018023519 6:159786090-159786112 TCATTTCATCACTACCATTTTGG - Intronic
1018793524 6:167168813-167168835 CTCAGTCATCTCTACAAGTTGGG - Intronic
1018823191 6:167389565-167389587 CTCAGTCATCTCTACAAGTTGGG + Intergenic
1018917272 6:168142437-168142459 ATCATTCATCATGACCAATTGGG - Intergenic
1021408728 7:20304197-20304219 CTCATTCACAAATAACATTTTGG - Intergenic
1022223268 7:28336045-28336067 ATCATTCATCACGACCAAGTGGG - Intronic
1024451688 7:49553477-49553499 CACATTGATCTCTAACATTTGGG - Intergenic
1024770793 7:52720622-52720644 TCCATTAATCACTAACATTTGGG + Intergenic
1024916604 7:54507327-54507349 CTCATTCATTACCACCATGATGG - Intergenic
1028206819 7:88027079-88027101 GTCATTCATCACAACCAAGTAGG - Intronic
1030725985 7:112924611-112924633 TCCATTAATCACTAACATTTGGG + Intronic
1031045491 7:116882426-116882448 ACCATTCATTACTACCATTATGG + Intronic
1031507297 7:122601144-122601166 ATTTTTCATCTCTACCATTTTGG + Intronic
1032253303 7:130276651-130276673 CCCATCCATCACTTCCATTCTGG + Exonic
1034752201 7:153580241-153580263 ATCATTCATCACGACCAATTGGG + Intergenic
1035916723 8:3632676-3632698 TTCATCCATCAGTACTATTTAGG + Intronic
1036558637 8:9883295-9883317 CTCAGCCAGCACTACCATCTGGG + Intergenic
1037502097 8:19496061-19496083 CTGATTCAACACCACCAATTTGG + Intronic
1038883037 8:31635855-31635877 CCCTTTCATAACCACCATTTAGG + Intergenic
1040720764 8:50319861-50319883 ATCATTCATCATAACCATGTGGG - Intronic
1044263202 8:90152178-90152200 ATCATTCATCTATATCATTTTGG + Intergenic
1047467974 8:125137686-125137708 CTCAATAATCACCACCCTTTGGG - Intronic
1049695063 8:143979497-143979519 CTCATTCTTCATTACTAGTTTGG - Intronic
1050420529 9:5459631-5459653 CTCAATTATCACTATCACTTCGG + Intronic
1051661588 9:19431984-19432006 CTCATTCATGACTTCAATTTAGG - Intronic
1061757263 9:132823934-132823956 CTCTTTGATCACTACCTCTTTGG - Intronic
1061915291 9:133748646-133748668 ATCATTCATCACGACCAAGTGGG - Intergenic
1185768715 X:2748511-2748533 CTAACTCCTCACTACCTTTTGGG + Intergenic
1186489075 X:9957364-9957386 CTAATTCATAAATACCATTTTGG - Intergenic
1189175520 X:38953361-38953383 TACAGTCATCACTACGATTTTGG - Intergenic
1193332511 X:80250809-80250831 CCCATTCTTCAGTTCCATTTAGG + Intergenic
1194024107 X:88730185-88730207 ATCATTCATCACAACCAAGTGGG + Intergenic
1194218437 X:91162114-91162136 ATCATTCATCATTACCTATTGGG - Intergenic
1194831917 X:98633437-98633459 CTCATTCATCAAGACCAAGTGGG + Intergenic
1195396628 X:104417661-104417683 ATCATTCATCACGACCAACTGGG + Intergenic
1195848839 X:109260286-109260308 ATCATTCATCATAACCATGTGGG - Intergenic
1196461062 X:115931529-115931551 CTCATTCATCACGACCAAGTGGG - Intergenic
1196984101 X:121249156-121249178 ATCATTCATCACGACCAAGTGGG - Intergenic
1198938595 X:141927400-141927422 ATCATTCATCACGACCAAGTGGG - Intergenic
1200554949 Y:4625874-4625896 ATCATTCATCATTACCTATTGGG - Intergenic
1201054057 Y:9970776-9970798 CTCATTCATAACTAAATTTTAGG - Intergenic
1201301663 Y:12510468-12510490 CTAATTCCTCACTACTTTTTGGG - Intergenic
1202102391 Y:21323934-21323956 CTCATTCATGACTAAATTTTAGG - Intergenic
1202203249 Y:22376843-22376865 CTCATTCATAACTAAATTTTAGG + Intronic
1202240061 Y:22757730-22757752 CTCATTCATGACTAAATTTTAGG + Intergenic
1202393047 Y:24391492-24391514 CTCATTCATGACTAAATTTTAGG + Intergenic
1202477738 Y:25278625-25278647 CTCATTCATGACTAAATTTTAGG - Intergenic