ID: 1120723125

View in Genome Browser
Species Human (GRCh38)
Location 14:87908599-87908621
Sequence CTCTGGGCGTGGAGTTAAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 160
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 149}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120723118_1120723125 13 Left 1120723118 14:87908563-87908585 CCAATGGTCAAAGGATTGGAATT 0: 1
1: 0
2: 1
3: 11
4: 133
Right 1120723125 14:87908599-87908621 CTCTGGGCGTGGAGTTAAGAGGG 0: 1
1: 0
2: 0
3: 10
4: 149
1120723114_1120723125 29 Left 1120723114 14:87908547-87908569 CCATTTGTTGTTTGGACCAATGG 0: 1
1: 0
2: 1
3: 13
4: 115
Right 1120723125 14:87908599-87908621 CTCTGGGCGTGGAGTTAAGAGGG 0: 1
1: 0
2: 0
3: 10
4: 149

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120723125 Original CRISPR CTCTGGGCGTGGAGTTAAGA GGG Intronic
900827125 1:4935727-4935749 ATCTGGGCATGGAGCTCAGACGG + Intergenic
902490753 1:16779036-16779058 CTCTGAGCCTGGAGTTGAGGGGG + Intronic
903035720 1:20491406-20491428 CTCTGGGCTTGGAGCTCTGAGGG + Intergenic
905592170 1:39173604-39173626 CTCTGGGCAGGGAGGGAAGAGGG + Intronic
909932756 1:81517126-81517148 CTCTGGGTGTGGAATTATGTAGG - Intronic
913610527 1:120505711-120505733 CTGTGGGTTTGGAGTTAAGCTGG + Intergenic
913984269 1:143551102-143551124 CTCTGGGTTTGGAGTTAAGCTGG - Intergenic
914580663 1:149016528-149016550 CTGTGGGTTTGGAGTTAAGCTGG - Exonic
915167143 1:153954269-153954291 CTCTGGGGGAGGAGATAAGTAGG + Exonic
915466658 1:156102328-156102350 CTCTGGGCCTGGGGTACAGAGGG + Intronic
918826572 1:189331410-189331432 CTCGGGGGGTGGAGCCAAGATGG - Intergenic
923529691 1:234803499-234803521 CTCTGAGCCTGGAGTTGAGGGGG - Intergenic
1065274154 10:24068273-24068295 CTGAGGGTGTGGAGCTAAGATGG - Intronic
1065833276 10:29634026-29634048 GTATGGGGGTGGAGTTCAGAAGG - Intronic
1069256410 10:66336361-66336383 TGCTGGGGGTGGAGCTAAGATGG - Intronic
1072189570 10:93068919-93068941 CTCTGGGCGCGGAGCGCAGAAGG - Intergenic
1073894490 10:108139130-108139152 TTGTGGGCATGGAGTTAGGAAGG - Intergenic
1078570438 11:12453118-12453140 CTCTGGGGTTTGAGTTGAGATGG + Intronic
1078919892 11:15819980-15820002 CTGTGGGTGTGGAGTCAAGCAGG - Intergenic
1080645970 11:34187809-34187831 CTCTGAGGGCTGAGTTAAGATGG + Intronic
1085310773 11:75515405-75515427 GTCTGGGTGTGGAGTTAGGTGGG - Intronic
1089218669 11:116852383-116852405 CTCTGGGCTGGGAGTCAGGAAGG - Intronic
1090712365 11:129399193-129399215 CTCTGGGAGTGCAGTTAATTAGG + Intronic
1091590830 12:1842195-1842217 ATCAGGGCGTGGAGTGCAGAAGG + Intronic
1091671493 12:2455200-2455222 AAGTGGGCGTGGAGTCAAGAGGG - Intronic
1094232500 12:28122983-28123005 CTCTGGGGGTGGAAATCAGATGG - Intergenic
1100428605 12:94510174-94510196 CTCTGTGCATGGCGTGAAGAAGG + Intergenic
1101111461 12:101490773-101490795 CTCTTGGCCTGGACTGAAGATGG - Intergenic
1104305532 12:127607544-127607566 GTCTGGGCGTGGGGGTCAGATGG + Intergenic
1108840829 13:54612634-54612656 CTATTGGCATGGATTTAAGAGGG + Intergenic
1110877635 13:80529373-80529395 CTCTGGGGGTGGAATAAATATGG - Intergenic
1110949378 13:81465182-81465204 CTCTGGGCGAGGAGCCAAGATGG - Intergenic
1116037094 14:39639658-39639680 TTCGGGGGGTGGAGCTAAGATGG - Intergenic
1119202380 14:72765976-72765998 CTCTGGGGAGGGAGTAAAGAAGG + Intronic
1120183364 14:81367793-81367815 CTCTGGGCCTGGAGGGCAGATGG + Intronic
1120723125 14:87908599-87908621 CTCTGGGCGTGGAGTTAAGAGGG + Intronic
1122917148 14:104864621-104864643 CTGTGGGCGTCCAGGTAAGACGG + Intergenic
1126187048 15:45840935-45840957 CTCTGGGCTTGTAAATAAGAAGG - Intergenic
1126685243 15:51242785-51242807 CTCTTGGTGTGGAATTATGAGGG - Exonic
1128234177 15:66056240-66056262 TTCTGGGCCTGGAGAGAAGAGGG + Intronic
1129126556 15:73446876-73446898 CTCTGGCTGTGGTGTGAAGATGG + Intronic
1129868831 15:78928256-78928278 GCCTGGGCGTGAGGTTAAGAAGG + Intronic
1130348459 15:83069249-83069271 CTCTGGGCGTGGGGGCAGGAGGG + Intergenic
1132329698 15:101003798-101003820 GGCTGGGCCTGGAGCTAAGAGGG - Intronic
1137687032 16:50393397-50393419 CTCTGGGGCTGGGGGTAAGAGGG - Intergenic
1139516280 16:67454169-67454191 CTGTGGGAGTGGAGTGGAGAGGG + Intronic
1142397343 16:89839734-89839756 CTCTGGGGGTGGGGTGAAAAGGG + Intronic
1144799313 17:17914141-17914163 CTCTGGGCGTGGACAGAGGAGGG + Intronic
1146936537 17:36815701-36815723 CTCTGGGCTGGGAGTCAAGGTGG + Intergenic
1146973665 17:37093021-37093043 CTATGGGCCTGGAGCTGAGATGG - Intronic
1148235181 17:45964002-45964024 CTCTGGGTGAGGAGGTGAGAGGG + Intronic
1151560755 17:74868236-74868258 CTCTGGGCTTGGAGTCAAACAGG + Intronic
1151855087 17:76715306-76715328 CTGTGGGCGTGGGGGTAAGGAGG + Exonic
1152459993 17:80437464-80437486 CACTGGGCTTGGGGTTAAGTGGG + Exonic
1153087383 18:1303429-1303451 CTCTGGGAGTGTAGTTCTGACGG + Intergenic
1156073070 18:33237171-33237193 CACTGGGCTTGGAATGAAGATGG - Intronic
1156084270 18:33380063-33380085 ATCTGGGGGTGGAGTGCAGAGGG + Intronic
1158326606 18:56319826-56319848 CTCTGGTTCTGGAGTTCAGAAGG - Intergenic
1160037795 18:75317529-75317551 CTCGGGGCGTGGGGTGACGATGG + Intergenic
1161383117 19:3976984-3977006 CTCTGGGCCTGGAGCTCTGAAGG - Intronic
1163383748 19:16986249-16986271 CTCAGGGCATGGAGGGAAGATGG - Intronic
1163450334 19:17373345-17373367 CTCTGGGCGAGGGGTTGAGGTGG + Intronic
1164001230 19:21101311-21101333 CTCTGGGTTTGTAGTGAAGAGGG + Intronic
1164007994 19:21169514-21169536 CTCTGGGTTTGTAGTGAAGAGGG + Intronic
1164141177 19:22465869-22465891 CTCTGGGTTTGTAGTAAAGAGGG + Intronic
1164253284 19:23503658-23503680 CTCTGGGTTTGTAGTGAAGAGGG - Intergenic
1164297140 19:23922048-23922070 CTCTGGGTTTGTAGTGAAGAGGG + Intronic
1164317628 19:24107842-24107864 CTCTGGGTTTGTAGTGAAGAGGG + Intronic
1166259298 19:41626863-41626885 CTCTGGGAGTGGTGGGAAGAGGG - Intronic
1166840807 19:45695815-45695837 CTCTGTGCGTGGAGTAGAGTGGG - Intronic
1166899038 19:46044196-46044218 CTCTGGGCGTGGGCTTATGTGGG - Intronic
1167442418 19:49516058-49516080 CTCTGGGCCTTGAGCAAAGAGGG + Intronic
1167480236 19:49725868-49725890 ATGTGGGAGGGGAGTTAAGAAGG - Intergenic
925529094 2:4839682-4839704 ATCTGGACGTGGAGTTGAGAGGG + Intergenic
928837929 2:35569187-35569209 CTCGGGGGGTGGAGCCAAGATGG - Intergenic
933257674 2:80099136-80099158 TTCGGGGGGTGGAGTCAAGATGG - Intronic
935726022 2:106024629-106024651 CTGAGGGTGTGGAGTCAAGAGGG + Intergenic
940200706 2:151147058-151147080 CTCTGGACATGGAATTATGATGG - Intergenic
948759634 2:240182752-240182774 ATCTGGGCCTGCAGTTTAGATGG - Intergenic
1169363683 20:4973564-4973586 CTCTGAGGAAGGAGTTAAGAAGG + Intronic
1170730075 20:18966261-18966283 CTCTAGGCGTGGAGTGAACCAGG + Intergenic
1173475594 20:43356861-43356883 CTCTAGGGGTGGAGTGAAGCTGG - Intergenic
1174396167 20:50248101-50248123 CTCTGGGCTTGGGGTTAGCAGGG + Intergenic
1177789885 21:25711390-25711412 CTATGGGCGTAGAGAGAAGATGG + Intronic
951303475 3:21027807-21027829 CCCTGGTGGTAGAGTTAAGAAGG - Intergenic
951953520 3:28228298-28228320 CTCTAGGCGTGGAGAAAACATGG + Intergenic
953569075 3:44057342-44057364 CTCTGGGGGTGGAGAGAGGAGGG - Intergenic
954465054 3:50649414-50649436 CTCTGGCCTTGGAGTTAGCATGG - Intergenic
954485963 3:50851446-50851468 TCCTGGGCGTGGAGTGGAGAAGG + Intronic
957582885 3:82098474-82098496 TTCTGGGCATGGAGTTAATCAGG - Intergenic
960155671 3:114295189-114295211 CTGTGGGCGAGGTGTAAAGAGGG + Intronic
961117361 3:124342009-124342031 CACTAGGGGTGGGGTTAAGAGGG + Intronic
963546980 3:146671964-146671986 GCCCGGGCGTGGAGTGAAGAAGG + Intergenic
966928762 3:184662406-184662428 CTCTGGGCGTGGACTAATGAAGG + Intronic
967662114 3:192125447-192125469 CACTGAGAGTTGAGTTAAGAAGG + Intergenic
971299241 4:25428314-25428336 GTCTGGGCGTGGATCTAGGAAGG + Intergenic
971614066 4:28764638-28764660 GCCTGGGCATGGAGTGAAGAGGG - Intergenic
973986838 4:56362747-56362769 CCCTGGGGGTGGAGCCAAGATGG + Intronic
975654370 4:76626939-76626961 CTGTGGGCGTGAATTCAAGAAGG - Intronic
979913836 4:126405174-126405196 CTCTGGGCATGGAGTGGGGATGG - Intergenic
979962418 4:127036691-127036713 GTCTGGGAGTGGAGCAAAGAGGG - Intergenic
984405855 4:179328877-179328899 CACTGAACGTGGAGTTAAAAAGG - Intergenic
985322546 4:188730943-188730965 CAATGAGCGTGGATTTAAGAAGG - Intergenic
985794256 5:1950236-1950258 CTCTCGGTGTGGAGGGAAGAGGG + Intergenic
986221861 5:5775543-5775565 GTGTGGGCCTGGAGGTAAGAGGG + Intergenic
991499495 5:67262956-67262978 CTCTGGGGCTGAAGGTAAGAAGG + Intergenic
994824790 5:104699028-104699050 GTCTGGGCTTGAAGTTGAGAGGG - Intergenic
997055483 5:130438498-130438520 GTCTGGGGGTGGAGTGAAGAGGG + Intergenic
999064835 5:148674326-148674348 GTCTGGGGGTGGAGCCAAGATGG - Intronic
1000026197 5:157361323-157361345 CTCTGGGCCTGCAGGTAAGAGGG + Intronic
1001087101 5:168708202-168708224 ATCTGGGCATGGAGTTGGGAAGG - Intronic
1001115444 5:168935432-168935454 CTCTGGTTGTAGAGATAAGATGG - Intronic
1002434820 5:179224817-179224839 GTCTGGGCGTGGAGCTGAGGTGG - Intronic
1002820873 6:723532-723554 CTCTGGGCATGGAGAGAGGATGG + Intergenic
1004286946 6:14329982-14330004 CTCAGGGATTGGAGTTCAGAGGG + Intergenic
1005816171 6:29554391-29554413 CCCTGCGCGTGGAGTTGTGAGGG - Intergenic
1006486805 6:34349533-34349555 ATGTGGGACTGGAGTTAAGAGGG + Intronic
1006787934 6:36680240-36680262 CTTTGGGCGTGGAGATAAGGTGG + Intronic
1010353450 6:74903758-74903780 ATCTGGGGGTGGAGCCAAGATGG + Intergenic
1010807049 6:80249650-80249672 CTCTTGGGGTGGAGGTAAGAGGG + Intronic
1018179744 6:161211924-161211946 CTCTGGGCCTTGAGTTGAAATGG - Intronic
1018683607 6:166284629-166284651 GTCAGGGCGTGGATTGAAGATGG - Intergenic
1019261532 7:84546-84568 CTCTGGGTGAGGAGTGAGGAAGG - Intergenic
1019384011 7:743429-743451 CTGTAGGCGTGGATTTAACAGGG - Intronic
1024085321 7:45887841-45887863 CTCTGGAGGGGCAGTTAAGAAGG - Intergenic
1027934848 7:84589275-84589297 GCCTGGGTGTGGAGTGAAGAGGG - Intergenic
1027934899 7:84589614-84589636 CCCTGGGCGTGGAGCAGAGAGGG - Intergenic
1028431215 7:90749292-90749314 GACTGGGCATGGAGTGAAGAAGG - Intronic
1028855617 7:95589273-95589295 CTGTGGGGGTGGAGGTAACAAGG + Intronic
1029313089 7:99686016-99686038 CTCGGGGGGTGGAGCCAAGATGG + Intronic
1031082995 7:117276368-117276390 CTCTGAGCTTGGTGTGAAGAAGG - Intergenic
1034960319 7:155360657-155360679 CTCTGGCCGGGGAGTCAGGAAGG - Intronic
1035093159 7:156331075-156331097 CTCTGGAAATTGAGTTAAGAAGG + Intergenic
1040739013 8:50548924-50548946 CTCTGGTCGTGAAATGAAGAAGG - Intronic
1043213153 8:77550881-77550903 CCCTGGGCATGGAGTAGAGAGGG + Intergenic
1045180063 8:99771049-99771071 CTCTAGGGGTGAAGGTAAGAGGG - Intronic
1046007771 8:108506427-108506449 CTCAGGGGGTGGAGCCAAGATGG - Intergenic
1047436961 8:124842825-124842847 CTTTGGGGGTGGGGTTGAGAAGG + Intergenic
1048753279 8:137703860-137703882 CTCTGTGCCTGGAGTCAAGGAGG - Intergenic
1049279051 8:141734938-141734960 TACTGGGCCTGGAGATAAGAAGG - Intergenic
1049392215 8:142377736-142377758 CTCTGGGGGTGCAGTGAAGAGGG - Intronic
1050034923 9:1424851-1424873 ATCTGGGTGTGGAGCCAAGATGG - Intergenic
1052913722 9:33907575-33907597 CTCTAGACGTGGAGTAGAGAAGG + Intronic
1054885055 9:70187629-70187651 TTCTGGGGGTGGGGTAAAGAGGG - Intronic
1057202830 9:93151972-93151994 CTCTGGTCGTGGAGATACGGAGG + Intergenic
1062217153 9:135395396-135395418 GTCTGGGCCTGGAGCCAAGACGG + Intergenic
1186297026 X:8160802-8160824 CTCTGGGAGATGATTTAAGAGGG - Intergenic
1186354971 X:8781750-8781772 CTCTGGGAGATGATTTAAGAGGG + Intergenic
1186377119 X:9016133-9016155 CTCTGGGAGATGATTTAAGAGGG + Intergenic
1188289317 X:28368203-28368225 TTCTGGGGGTGGAGCCAAGATGG - Intergenic
1192219021 X:69184443-69184465 CACTGGGAGTGGAGTGGAGAAGG - Intergenic
1192917281 X:75666224-75666246 CTCTGGGCATGGAGTGGAGAGGG + Intergenic
1192917305 X:75666337-75666359 CTCTGGGGGTGGAGCAGAGAGGG + Intergenic
1193399261 X:81022198-81022220 CCCTGGGCGAGGTGTGAAGATGG - Intergenic
1193780896 X:85699620-85699642 TCCTGGGGGTGGAGTCAAGATGG - Intergenic
1194928473 X:99858346-99858368 TTCTGTACGTGGGGTTAAGAAGG - Intergenic
1195416168 X:104621617-104621639 GTCTGGGTGTGGAGTGGAGAGGG - Intronic
1196896706 X:120344232-120344254 TTCTGGGAGTGGAGCGAAGATGG + Intergenic
1198769355 X:140112502-140112524 CTCTGGGTGTGGAGTTGCAAAGG - Intergenic
1198985203 X:142443386-142443408 ATCTGGACCTGGAGTTGAGAAGG - Intergenic