ID: 1120726409

View in Genome Browser
Species Human (GRCh38)
Location 14:87946731-87946753
Sequence CCTGTGTTTCACAAAATTAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 264
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 245}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120726406_1120726409 3 Left 1120726406 14:87946705-87946727 CCAAGCGAGCAACAGATTTTAAA 0: 1
1: 0
2: 0
3: 20
4: 206
Right 1120726409 14:87946731-87946753 CCTGTGTTTCACAAAATTAATGG 0: 1
1: 0
2: 1
3: 17
4: 245

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120726409 Original CRISPR CCTGTGTTTCACAAAATTAA TGG Intronic
901303247 1:8214931-8214953 CCAGTGTTTCCCAAACTTACTGG - Intergenic
901708848 1:11098039-11098061 CCTGTGTTTCGCAAAATGCTTGG + Exonic
901943742 1:12684110-12684132 CCTGTGTCTCACCAAATACATGG + Intergenic
903663872 1:24995217-24995239 CCTGTGTTTCTAAAACTCAAGGG - Intergenic
905839960 1:41167853-41167875 CCTGTCTTTCAAAAAACAAAGGG - Intronic
908131105 1:61076463-61076485 CCTGGGTTCCACAAAATTAAAGG - Intronic
909957440 1:81797412-81797434 ACTGTGTTGCTCAAACTTAATGG + Intronic
912104445 1:106253929-106253951 CCTCTGTCTCACAATATTGAAGG - Intergenic
912662219 1:111542407-111542429 CCAGTTTTTCACCAAATAAATGG - Intronic
913600393 1:120416081-120416103 CCAGTGCTTCACGAAGTTAAAGG + Intergenic
914086660 1:144460562-144460584 CCAGTGCTTCACAAGGTTAAAGG - Intronic
918981868 1:191571633-191571655 CCTCTGTCTCAGTAAATTAAAGG - Intergenic
919458630 1:197849461-197849483 CCTGTTTTTCAAAAAATTGGGGG - Intergenic
919503479 1:198368254-198368276 TCAGTGTTTCACAAATTGAAAGG + Intergenic
922004791 1:221519120-221519142 CTTGTGGTACAAAAAATTAATGG + Intergenic
922303564 1:224324834-224324856 CCTGTGGCTCCCAAAATTCATGG - Intronic
922523634 1:226279830-226279852 CCTGTTTTTTAAAAAATGAAAGG - Intronic
922744124 1:228034772-228034794 CCTGTTTTCCACAAACTTTAAGG - Intronic
923970070 1:239190389-239190411 ACTGTGTTAAACAAAATTATGGG - Intergenic
1063891841 10:10638211-10638233 CATGTGTTTAAAAAAATTCATGG + Intergenic
1064546171 10:16451883-16451905 ACTGAGTTTCCAAAAATTAAAGG - Intronic
1067315005 10:45152593-45152615 CCTGCTTTTCAGAAATTTAAAGG + Intergenic
1067779557 10:49189758-49189780 TCTGAGTTTCACATAAATAATGG + Intergenic
1068124291 10:52819065-52819087 CCCGTATTTCTCAAAATTTAAGG - Intergenic
1069692835 10:70364967-70364989 CCAGTGATTCTCAAAATTCAAGG + Intronic
1069702188 10:70435020-70435042 CTTGTCTTTCATAAAATTAGGGG - Intronic
1076133979 10:128032021-128032043 ACTCTGTTTCAAAAAAATAAAGG - Intronic
1076172115 10:128327920-128327942 TCTATTTTTCACAAAATTTAGGG + Intergenic
1077361581 11:2143081-2143103 CCTGAGTTTCATAAAATGGAGGG - Intronic
1077585349 11:3447409-3447431 GCTATGTGTCACAAAATTGAAGG + Intergenic
1078009106 11:7557324-7557346 CATATGTTTTACATAATTAAAGG - Intronic
1078161862 11:8847007-8847029 TATCTCTTTCACAAAATTAAAGG + Intronic
1079844504 11:25448187-25448209 CCTGTTTTGCACATATTTAATGG - Intergenic
1080000911 11:27348127-27348149 CCTTTGTTTCATACAACTAAAGG + Intronic
1084933475 11:72574852-72574874 CCTGTTTTTCACCAAATGGAGGG - Intergenic
1085240364 11:75048712-75048734 GCTTAGTTTCACAAAATTATTGG + Intergenic
1087877847 11:103379299-103379321 CTTGTGTTTGACAAAATAAAAGG - Intronic
1088946560 11:114519097-114519119 GCTGTGTTTCTCAAAATTGTGGG - Intergenic
1089236358 11:117029664-117029686 CCAGTGGTACACAAAATTCAAGG + Intronic
1090061993 11:123472275-123472297 TCTGTGTTTAACAAAAGAAAAGG - Intergenic
1091072886 11:132585548-132585570 ACTGTGTTAAACAAAATTATCGG - Intronic
1092477825 12:8834100-8834122 CCTGTTCCTCACAAACTTAATGG + Intronic
1093134149 12:15429963-15429985 TCTCTGTTTCAGAAAATAAATGG - Intronic
1094579874 12:31724772-31724794 CATGTGTTTCCCAAAGTAAATGG + Intronic
1098086924 12:66855839-66855861 TCAGTGTTTCACAAACTTATAGG - Intergenic
1098731933 12:74047049-74047071 CCTCTCTTTCACAAAATTCCTGG - Intergenic
1099024308 12:77446421-77446443 CCTGTGTTTCACAAATTGACTGG + Intergenic
1099108833 12:78530842-78530864 GCTGTGTTTGACAGAGTTAAAGG - Intergenic
1100204986 12:92339176-92339198 CCTCTGTTACACCAAATTTATGG + Intergenic
1100492488 12:95094486-95094508 CATGTGTTTCAGAAAATGATTGG - Intronic
1100868560 12:98885681-98885703 CCTTTATTTCACCAAATTGACGG - Intronic
1101095817 12:101339493-101339515 CCTTTATTTAATAAAATTAAAGG + Intronic
1101553770 12:105787481-105787503 CCAGTGTTAAAGAAAATTAAAGG - Intergenic
1101757665 12:107633774-107633796 CCTGTGGTTCTCAAACTTAAGGG + Intronic
1102609658 12:114100433-114100455 CCTGGTCTTCACAATATTAAAGG - Intergenic
1104706881 12:130954314-130954336 GCTGTGTTTCACAAACTTTAAGG + Exonic
1105305815 13:19168330-19168352 CCTGTCTTTAAAAAAATTAATGG + Intergenic
1105621840 13:22075368-22075390 CCTGTAAATCAGAAAATTAATGG - Intergenic
1108568704 13:51728535-51728557 CCTGTTTTACACAAAATCATGGG - Intronic
1109837001 13:67873150-67873172 GCTGTGGTTCACAGAATTCAAGG + Intergenic
1110453100 13:75659316-75659338 ACTGTATTTCACCACATTAATGG - Intronic
1111291211 13:86172301-86172323 ATTATGTTTTACAAAATTAAGGG - Intergenic
1111690134 13:91553401-91553423 ACTGTGTTTTAAAAAAATAAAGG - Intronic
1111995397 13:95160706-95160728 CCTGTGTTTCCAGAAATGAACGG + Intronic
1112125035 13:96455861-96455883 CCTCTGTTTCACAAAAGCACAGG - Intronic
1112847389 13:103660768-103660790 GATATGTTTCACAAGATTAAGGG - Intergenic
1113154896 13:107308621-107308643 TCTATGTTTCTAAAAATTAATGG + Intronic
1114975665 14:28095222-28095244 CATCTTTTTCAGAAAATTAAAGG - Intergenic
1115044642 14:28976467-28976489 ACTGTATTTCAAAAAATTAATGG + Intergenic
1116088252 14:40269443-40269465 CTTGTGTATCAGAAAATAAAGGG - Intergenic
1116114980 14:40636164-40636186 CCTCTGTTTCACGAAATAAATGG - Intergenic
1116632525 14:47354015-47354037 ACTGTGATTCACTACATTAATGG + Intronic
1117190366 14:53284480-53284502 CCTGCCTTTCAGAAAATTCAGGG - Intergenic
1117290193 14:54324844-54324866 ACTGTGTTGCACAAAATTGGGGG - Intergenic
1118578549 14:67269711-67269733 CCGGTTTTTCACAAAACTCAAGG - Exonic
1118972701 14:70650623-70650645 TCTGATTTTCAGAAAATTAAGGG + Intronic
1119638351 14:76294610-76294632 ACTCTGTCTCAAAAAATTAAAGG - Intergenic
1120367601 14:83590861-83590883 ACTGTGTAGCACAGAATTAATGG + Intergenic
1120713428 14:87816251-87816273 CCTGTGTTCAACAAATTTTATGG + Intergenic
1120726409 14:87946731-87946753 CCTGTGTTTCACAAAATTAATGG + Intronic
1121849664 14:97209133-97209155 TACGTGTTTGACAAAATTAAAGG + Intergenic
1125261800 15:37834383-37834405 TGTATGTTTCAGAAAATTAAGGG + Intergenic
1128413275 15:67420363-67420385 CCTGTATTTCACAAATTTGCTGG - Intronic
1129009058 15:72398366-72398388 CCTGAGGTTCCCAAAATAAAGGG + Exonic
1129145258 15:73641331-73641353 GCTGTGCTGCACAGAATTAAGGG + Intergenic
1131042161 15:89279741-89279763 CTTGTGTTTGAGAAAATAAAAGG - Intronic
1131095894 15:89654307-89654329 CCTGGGATTCAAAATATTAAGGG + Intronic
1131108225 15:89748938-89748960 CCTGTGTTTCAGACACTTGAAGG + Exonic
1131828217 15:96336652-96336674 CCTGGGTTTTAAAAAATAAAGGG + Intronic
1135103248 16:19624985-19625007 CCTGTTTTTAAGAAAATCAATGG - Intronic
1135419300 16:22294274-22294296 CCTGTGTTGAACAGAACTAATGG + Intergenic
1136868956 16:33785123-33785145 CTTGTGATTCACAATATGAATGG + Intergenic
1136937069 16:34480510-34480532 CTTGTGATTCAGAAAATGAATGG - Intergenic
1136962750 16:34868060-34868082 CTTGTGATTCAGAAAATGAATGG + Intergenic
1137425457 16:48376221-48376243 CCAATGTTTCATAAAATTATTGG + Intronic
1138542075 16:57694652-57694674 GCTGTGTTTCACAAAAATTTTGG + Intergenic
1138705187 16:58908423-58908445 TCTGTGATTCACAAAAATAGGGG + Intergenic
1141106737 16:81240269-81240291 CCTATGTTTTAAAAAGTTAAAGG - Intronic
1203103217 16_KI270728v1_random:1330945-1330967 CTTGTGATTCACAATATGAATGG - Intergenic
1143828025 17:9628581-9628603 AATGTGTTTCACAAAAATATAGG - Intronic
1146060966 17:29607130-29607152 CATGTTATTCACAAAATTATAGG + Intronic
1148058841 17:44820278-44820300 GCTTAGTTTCACAAAATTCAAGG - Intronic
1148536232 17:48441328-48441350 CCTGGGTTACAGCAAATTAATGG + Intergenic
1151118848 17:71769613-71769635 CCTGTTTTGAACAATATTAATGG + Intergenic
1153028080 18:689209-689231 CCTGCGGTCCACAAAATGAATGG + Intronic
1153994170 18:10425433-10425455 CCTTAGTTTCTCAAAACTAAAGG + Intergenic
1154392476 18:13951759-13951781 CCTGTATTTAAAAAGATTAAAGG - Intergenic
1155744099 18:29329809-29329831 CCATTGTTTCAGATAATTAAGGG - Intergenic
1156974968 18:43209581-43209603 CCTGTGGTTACCAAAATTCATGG + Intergenic
1157049021 18:44138195-44138217 ACTATGTTTTACAAAATTATTGG - Intergenic
1159866056 18:73706376-73706398 CTTGAGTTTCATAAAACTAAAGG - Intergenic
1159879728 18:73846893-73846915 CATGCATTTCACAAAATAAATGG - Intergenic
1159928160 18:74287352-74287374 TCTATGTTTTTCAAAATTAAGGG + Intronic
1160303206 18:77705167-77705189 CCTGTGTTTCACAAAGTTCCAGG + Intergenic
1162696800 19:12482957-12482979 CCTGTGTTTGAAGAAATCAAAGG + Intronic
925816554 2:7757075-7757097 CCTGTTTTACAGAATATTAATGG - Intergenic
926785683 2:16516183-16516205 CCTATTTTTTAAAAAATTAAGGG + Intergenic
928107186 2:28478074-28478096 CCTGTGTTCCTCAAATTTCAGGG + Intronic
928222414 2:29415548-29415570 CCTGTGTTTTCCAAACCTAATGG - Intronic
928726293 2:34177582-34177604 GTTGTTTTTCACAAAATTGAGGG - Intergenic
929366996 2:41170992-41171014 AGTGTTTTTCACAAAATCAAAGG + Intergenic
929818187 2:45252708-45252730 CTTGTATTTCACAAAATAATTGG + Intergenic
930689092 2:54340692-54340714 TCTTTGTTTCACAAACATAAAGG - Intronic
931606345 2:64056837-64056859 ACTGTGTTACACAACATTAGGGG - Intergenic
931942571 2:67268574-67268596 CCTGTGTGTCCCAAAATGTATGG - Intergenic
932306955 2:70710566-70710588 CCTGTGATTCACAAAGCCAAAGG - Intronic
933853927 2:86395403-86395425 CCTCTGTTTCCCTAAATGAATGG + Intergenic
935461853 2:103345763-103345785 GCTGTGTGTCACAAAAGGAAGGG - Intergenic
936649991 2:114414634-114414656 CCAATGTTTCTCAAATTTAAAGG - Intergenic
936910606 2:117588659-117588681 CATTTGTTTCACAAAATCAGGGG - Intergenic
939508136 2:143074472-143074494 CCTGTCTTTCACCATATTATTGG + Intergenic
942966347 2:181897403-181897425 CCTGATTTTTAGAAAATTAAAGG + Intronic
943333580 2:186588552-186588574 CCTGTGTTTAAAAAAAAAAAAGG - Intergenic
943429474 2:187780773-187780795 CCTGTGTTTTATAGAATAAATGG - Intergenic
944253117 2:197597941-197597963 CCTATATTTCACTAAATGAATGG - Intronic
944641892 2:201735628-201735650 CCTGGGTTTTACATAGTTAAAGG - Intronic
946943957 2:224800505-224800527 CCTGTCTTTGGCCAAATTAACGG - Intronic
947265798 2:228279022-228279044 CCTGTGTATATCAAAATTCATGG - Intergenic
1169939227 20:10919118-10919140 CCTGTGTTTCTGAAGATCAAGGG + Intergenic
1170854818 20:20042023-20042045 ACTATATTTCACTAAATTAAGGG + Intronic
1173647647 20:44643565-44643587 CCAGAGTTACACAAAATTGATGG + Intronic
1175047540 20:56121346-56121368 CCTCTGTGTTACAAAATCAAGGG - Intergenic
1177300072 21:19232308-19232330 TCTGTGTTTAGAAAAATTAAAGG + Intergenic
1177528302 21:22327571-22327593 ACTATGTTTCACAAAATCACTGG - Intergenic
1178010511 21:28280298-28280320 CCAGCGTTTTACAAAATTATGGG + Intergenic
1178289075 21:31351135-31351157 CCTGTATCTCAAAATATTAAAGG + Intronic
1178667208 21:34558807-34558829 CCTGTCTGTCGCAAAATCAACGG + Intronic
1183141463 22:35944999-35945021 TCTGTGTCTAACAAAATGAAAGG + Intronic
954962985 3:54582360-54582382 CTTTTGTTCCACAATATTAATGG - Intronic
955734194 3:62019114-62019136 CATCTGTTTCACATAATTCAGGG + Intronic
956493155 3:69795716-69795738 ACCGTGTTTCAGAAAATAAAAGG + Intronic
959093177 3:101925541-101925563 ACTGTGTTTCACAATGTTTATGG + Intergenic
959332151 3:105020107-105020129 CCTGAGTATCACAAGATTAAGGG - Intergenic
960122743 3:113963912-113963934 CCTGTGTTTTTCAAGATGAATGG - Intronic
962651897 3:137503153-137503175 CCTTTTTCTCAGAAAATTAATGG - Intergenic
963079755 3:141380222-141380244 AGCGTGTTTCACAGAATTAAAGG - Intronic
963535534 3:146523225-146523247 CCAGTGTCTCACATAATGAAGGG - Intronic
965425726 3:168520334-168520356 GCTGTGTTTTAGAAAATTGAAGG + Intergenic
965477187 3:169171364-169171386 CCTGTCTTTAACAAGAATAAAGG - Intronic
970763717 4:19521469-19521491 CTTGACTTTCACAAAAATAAAGG - Intergenic
970877500 4:20888772-20888794 CTTGTCTTTCTCCAAATTAAGGG + Intronic
971091273 4:23348468-23348490 CCTGAGTTTCAAGATATTAATGG - Intergenic
971146076 4:23977827-23977849 CCTGTTTGTCAAAAATTTAAAGG + Intergenic
973869469 4:55150697-55150719 ATTGTGTTTTACAAAATAAAAGG + Intergenic
975826093 4:78320851-78320873 CCTGTGTGTCACAAAAGCCAGGG - Intronic
976559793 4:86488310-86488332 CCGGTTTTTCACAACAGTAAGGG + Intronic
977242979 4:94595706-94595728 GCTGTGTTTCACAAACATACTGG + Intronic
977869736 4:102077304-102077326 CCAGTGTTTCTCAAACTTAATGG - Intergenic
978793486 4:112686446-112686468 GCTGTGTTTCATAAAAGTAAGGG + Intergenic
979818288 4:125138422-125138444 ACTGTGATGCACAAAATTGAAGG - Intergenic
981628650 4:146791158-146791180 CATGTTTGTAACAAAATTAAAGG - Intronic
983360115 4:166716836-166716858 CCTTTGTCTCAGAAAATGAAAGG - Intergenic
985039390 4:185874283-185874305 CCTGTTTTTCACAGAAATATTGG - Intronic
986630156 5:9764149-9764171 CTTGTGTTTTAAAAAATAAAAGG + Intergenic
987641655 5:20619841-20619863 CTTATGTTTTACAAAATAAATGG + Intergenic
988947103 5:36215223-36215245 AAAGTGTTTCACATAATTAATGG - Intronic
991181541 5:63756969-63756991 CCTGTGGTTCTCAAACTTCAGGG - Intergenic
992036959 5:72789362-72789384 CCTGTGCTTTAGATAATTAAGGG - Intergenic
993224271 5:85145813-85145835 CATGTGTTTCAAAAGCTTAAGGG + Intergenic
995062982 5:107831504-107831526 ACTGTGGTGCACAATATTAAAGG - Intergenic
995089081 5:108151350-108151372 TCTTTGCTTCACAAAATTACAGG + Intronic
996760662 5:126983233-126983255 CCTGTTTTTCAGTAAATGAAGGG + Intronic
996797759 5:127368397-127368419 CTTGTGTTTTCCAAAATTTATGG + Intronic
996980206 5:129482468-129482490 CCTGTTTTTCTCCAAATTAAGGG + Intronic
998577275 5:143329669-143329691 CCTCTATTTCACAGAAATAAAGG + Intronic
998627855 5:143865813-143865835 ACTGTGTCTAACAAAAGTAAAGG - Intergenic
998758020 5:145402073-145402095 TCTGTTTTTCACAAATTTTATGG - Intergenic
1000577464 5:162992198-162992220 CCTGTCTTTCAGTAACTTAATGG - Intergenic
1001576633 5:172768993-172769015 CCTCTGCTTCACAAACTCAAAGG + Exonic
1001804120 5:174568802-174568824 TCTGTGTCTCACAGAATTCACGG - Intergenic
1002407062 5:179043201-179043223 TTTGTGTCTCACAAAAATAATGG + Intergenic
1004231290 6:13835854-13835876 CAGGTGTTTGACAAAATTCAAGG + Intergenic
1008167573 6:48157738-48157760 ACTATCTTTCTCAAAATTAAAGG - Intergenic
1010115344 6:72300375-72300397 CCTGTGTTTTACAATATTTGGGG - Intronic
1010327461 6:74581550-74581572 CTTGTGTTTCACAGAAAAAATGG + Intergenic
1010605302 6:77882281-77882303 CTGGTGTTTCACAGAATTATTGG + Intronic
1010973224 6:82284696-82284718 TCTGTTTTTCAGAAAATGAACGG + Intergenic
1011621892 6:89250946-89250968 CCTGTGTCTGAAAAAAATAAAGG - Intergenic
1011724581 6:90197220-90197242 CCTCTGTATCACAAAAATGAAGG + Intronic
1011769987 6:90665078-90665100 CCTGAGTTTCACAGAAGTTAAGG - Intergenic
1011990993 6:93517202-93517224 CCTATGTTTGAAAAAATTAATGG - Intergenic
1013449640 6:110267139-110267161 CTTGAGTTTCACTAAATTTATGG + Intronic
1014116333 6:117672407-117672429 CCTGTGCTTCATAAAATTTTGGG + Intergenic
1014670253 6:124294859-124294881 GCTGTGTTTCAGAAAATGACAGG - Intronic
1014684799 6:124483108-124483130 ACTGTGTTTCAAAAAAAAAAAGG + Intronic
1016633725 6:146262171-146262193 ACTGTTTTTCACAAAATTCTTGG - Intronic
1016803716 6:148191616-148191638 ACTGTGTTTTACTAAATTGAGGG - Intergenic
1018741188 6:166729859-166729881 CCTGTGTGTGACGAAATTCAAGG + Intronic
1018833107 6:167461233-167461255 CCTGTGTTTAACACATTTAAGGG - Intergenic
1019227564 6:170526640-170526662 CATGTTTTTCACAAATTTGAAGG - Intergenic
1019641904 7:2107765-2107787 CCTATGTTTCAAAACATTAGAGG + Intronic
1020841806 7:13227169-13227191 CATGTGTCACACAAAATTAGAGG - Intergenic
1021267078 7:18537992-18538014 TCTGTGCTTCACAAGCTTAATGG + Intronic
1023026316 7:36053614-36053636 CCTGTATTTTAGAAAAATAAAGG - Intergenic
1023058018 7:36305190-36305212 CATGTGTTTGAACAAATTAAAGG + Intergenic
1023340345 7:39212888-39212910 CCTATGTTTCAAAAAAGCAAAGG - Intronic
1024878668 7:54058666-54058688 ACTGTCTTTCACAGAGTTAAAGG - Intergenic
1026400326 7:70005304-70005326 CTTTTGTGTCACAAAAGTAAAGG + Intronic
1029043546 7:97602755-97602777 TCTGTGTTTCACATATTTTAGGG - Intergenic
1029918899 7:104241193-104241215 CTTGTGTTTCACAAAAGTTGGGG + Intergenic
1030227893 7:107171985-107172007 CCTGCATATCACAAAATTCAGGG + Intronic
1031911954 7:127526781-127526803 CCTGTGGGTCACAAAATTGGTGG + Intergenic
1033184237 7:139211372-139211394 GATGTGTTTCCAAAAATTAAAGG + Intergenic
1034010107 7:147520536-147520558 CCTGTGTCTCAGAAACTTAGAGG - Intronic
1035179572 7:157079427-157079449 CCTATTTATCACAAAATTTATGG + Intergenic
1035841661 8:2818323-2818345 CCAGTGTTTAGTAAAATTAATGG - Intergenic
1035893972 8:3376632-3376654 TTTGTCTTTCACAAAATTAGAGG + Intronic
1035983026 8:4394305-4394327 CCTATGTTTCAATAATTTAATGG + Intronic
1037864785 8:22434883-22434905 CCATGGTTTAACAAAATTAAAGG - Intergenic
1038247444 8:25872102-25872124 CTTCTGTTTCACAAAAATGAAGG + Intronic
1038259263 8:25978992-25979014 CCTCCGTGTCACAAGATTAAGGG - Intronic
1040011829 8:42667654-42667676 CCTGTTTTTCAAAAAACTATTGG + Intergenic
1042409951 8:68453435-68453457 ACATTGTTTAACAAAATTAAAGG - Intronic
1044348720 8:91137911-91137933 ACTGTGTTTCACAAAAAGCATGG - Intronic
1045892610 8:107175082-107175104 CCTCTGTAGCACAAAATTGAAGG - Intergenic
1046163472 8:110397426-110397448 CCTGTGTTTCACCAGTTTCATGG + Intergenic
1046808966 8:118511820-118511842 CTTGTGTTTTACAAAATAAATGG - Intronic
1047298757 8:123594616-123594638 TTTGTGACTCACAAAATTAATGG - Intergenic
1048113471 8:131493096-131493118 TCTCTGTTTCACACAATAAAAGG - Intergenic
1051037865 9:12770672-12770694 CCTGTGTTTCATAAAATCATTGG - Intergenic
1051412763 9:16808173-16808195 CCTGTGTTTAAAAAATTTTAAGG - Intronic
1052276682 9:26684537-26684559 CCTTTGTTTCAAAAAAGGAATGG - Intergenic
1055001094 9:71449364-71449386 CATATTTTTTACAAAATTAATGG + Intergenic
1055566336 9:77572412-77572434 CCTTTCTTTCATAAAATGAAAGG + Intronic
1056792805 9:89637127-89637149 CCTGAGTTTAAGGAAATTAAAGG + Intergenic
1059497994 9:114725921-114725943 TCTGTCTTTCACCAAATAAAAGG - Intergenic
1059736053 9:117101119-117101141 TCTGTGTTTAACAGAATGAAAGG + Intronic
1059776912 9:117485158-117485180 CCCGTGTTTCAGCAAAGTAAAGG + Intergenic
1060163189 9:121385925-121385947 TCTGCATTTCATAAAATTAAGGG + Intergenic
1060624995 9:125103755-125103777 CCTGAGTTTCACAAACTTATAGG + Intronic
1186386968 X:9119824-9119846 CCAGTGTTTCAAAAAAAAAAGGG - Intronic
1187499406 X:19826811-19826833 CATATAATTCACAAAATTAATGG + Intronic
1188352051 X:29144081-29144103 TCTATGGTTCACAAAGTTAATGG + Intronic
1188357552 X:29211328-29211350 CCTGTGTTCTAAAGAATTAATGG + Intronic
1188403597 X:29778915-29778937 CCAGTGCTTCTCAAACTTAAAGG + Intronic
1188789029 X:34385734-34385756 CCTATATTTCTCAAAATAAATGG - Intergenic
1189232611 X:39464242-39464264 CTCTTGTGTCACAAAATTAAAGG + Intergenic
1189827761 X:44937374-44937396 CCTGTGTATCACAAATCTATTGG + Intronic
1190787672 X:53667965-53667987 CCTGTGTTTCATAAATGAAAGGG - Intronic
1193848208 X:86501422-86501444 CCTGTCTTCCAGAAAGTTAATGG - Intronic
1195015522 X:100776032-100776054 ACTGTCTTTCAAAAAATGAAGGG - Intergenic
1195522519 X:105847902-105847924 CCACAGTTTCACAAAACTAATGG + Intronic
1199216080 X:145261913-145261935 TCTGTGTTTCACAAAAGGTAGGG + Intergenic
1202148126 Y:21821230-21821252 CAGGTGTTTCACAACATGAAGGG + Intergenic