ID: 1120731191

View in Genome Browser
Species Human (GRCh38)
Location 14:88003100-88003122
Sequence CTACTCATGGGGTAATGGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120731191_1120731200 -3 Left 1120731191 14:88003100-88003122 CCTCCCCATTACCCCATGAGTAG No data
Right 1120731200 14:88003120-88003142 TAGCCCAACTGGCCAGTGTTGGG No data
1120731191_1120731199 -4 Left 1120731191 14:88003100-88003122 CCTCCCCATTACCCCATGAGTAG No data
Right 1120731199 14:88003119-88003141 GTAGCCCAACTGGCCAGTGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120731191 Original CRISPR CTACTCATGGGGTAATGGGG AGG (reversed) Intergenic
No off target data available for this crispr