ID: 1120731591

View in Genome Browser
Species Human (GRCh38)
Location 14:88008917-88008939
Sequence GGGGTCCTCACTTGGAAACT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 196
Summary {0: 1, 1: 1, 2: 2, 3: 15, 4: 177}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120731591_1120731596 -3 Left 1120731591 14:88008917-88008939 CCTAGTTTCCAAGTGAGGACCCC 0: 1
1: 1
2: 2
3: 15
4: 177
Right 1120731596 14:88008937-88008959 CCCACAGGCCACAACTACTTAGG 0: 1
1: 0
2: 1
3: 7
4: 95
1120731591_1120731598 -2 Left 1120731591 14:88008917-88008939 CCTAGTTTCCAAGTGAGGACCCC 0: 1
1: 1
2: 2
3: 15
4: 177
Right 1120731598 14:88008938-88008960 CCACAGGCCACAACTACTTAGGG 0: 1
1: 0
2: 0
3: 11
4: 81

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120731591 Original CRISPR GGGGTCCTCACTTGGAAACT AGG (reversed) Intronic
900820576 1:4884073-4884095 GGTGTCCTCATTTGTAAAATAGG - Intergenic
902629087 1:17694283-17694305 GGTGTCCTCACTTGTAAAAGGGG - Intronic
902651319 1:17839452-17839474 GGTGTCCTCACTTGGTAGCTGGG - Intergenic
903000415 1:20261639-20261661 AGGTTCCTCACTGGGAAAATAGG - Intergenic
903577692 1:24349062-24349084 GGTTTCCTCACTTGTAAAATGGG - Intronic
903970830 1:27117768-27117790 GAGGTCCTCCCTTAGACACTAGG - Intronic
904792680 1:33035706-33035728 AGGGGCCTCACTTGGGATCTGGG - Intronic
904819252 1:33230180-33230202 AGTTTCCTCACTTGTAAACTGGG + Intergenic
906652794 1:47524815-47524837 GGGGTGCTCAGGTGGAAAGTAGG + Intergenic
908493518 1:64670573-64670595 GGACTTCTCACTTGGAACCTTGG - Intronic
911294953 1:96103637-96103659 GGGCTCTTCAGTTGGAAACCTGG + Intergenic
916050754 1:161034992-161035014 GGCGCCCTCACTTGGAGTCTTGG - Intronic
916503372 1:165406232-165406254 GGGCTCCTCATTTGGAAAGGTGG - Intronic
919777256 1:201202336-201202358 GGCTTCCTCACTTGTGAACTGGG + Intronic
921640845 1:217551778-217551800 GGTTTCCTCCCTTGAAAACTGGG - Intronic
922640558 1:227226249-227226271 TGGGTTCTGACTTGGAATCTCGG - Intronic
922778071 1:228226564-228226586 TGGGGCCTCATTTGGAAACAGGG + Intronic
923003225 1:230024697-230024719 GTGGTCCTCACCTGGAAGGTGGG - Intergenic
1065876023 10:29997789-29997811 GGGATCCTGACTTGTAAACGGGG + Intergenic
1067058000 10:43063557-43063579 GGGGTCCTCAGTTGGAGATGAGG + Intergenic
1067293959 10:44963826-44963848 GGTGTCCTCACTTGGCAAAAGGG - Intronic
1068852283 10:61757660-61757682 TGGGCACACACTTGGAAACTTGG - Intronic
1070653623 10:78255654-78255676 CGGCTTCTAACTTGGAAACTGGG - Intergenic
1071713677 10:88074220-88074242 GGTGTTCTCACCTGGAAATTGGG + Intergenic
1071743652 10:88390576-88390598 GGGGACCTTTCTTTGAAACTTGG + Intronic
1072734446 10:97869465-97869487 TGGGGCCTCACTTGGGACCTCGG - Exonic
1074229645 10:111521217-111521239 TGTGTCCTCATTTGGAAAGTGGG - Intergenic
1074379072 10:112963868-112963890 GTGGTCCTCCCTTAGAAAATTGG + Intronic
1075258438 10:120943618-120943640 TGGATCCACACTTGGAAACGAGG - Intergenic
1075617834 10:123904417-123904439 GGGGTCTTCATCTGGAAAGTGGG + Intronic
1076003312 10:126929281-126929303 GGTGTGCTCACCTGTAAACTGGG + Intronic
1076184620 10:128436631-128436653 TGGGGCCTCACTTGAAAACTGGG - Intergenic
1076409671 10:130236970-130236992 CGGGTCCTCACTAGGAGGCTTGG + Intergenic
1077502533 11:2915916-2915938 TGAGTCCCCACCTGGAAACTTGG - Intronic
1078629238 11:12987054-12987076 AGGGTCCTCATCTGGAAACTGGG + Intergenic
1083704214 11:64502194-64502216 GGGTTCCTCATTTGTAAAATGGG - Intergenic
1088503568 11:110507803-110507825 AGGCACGTCACTTGGAAACTTGG - Intergenic
1088646369 11:111919795-111919817 GTGGGCCTCAGTTGGAATCTTGG - Intronic
1089647676 11:119890788-119890810 GGAGTCCTCACCTGGTAGCTGGG - Intergenic
1090264216 11:125343958-125343980 GGGCTCCTCTCTGGGAAACCTGG + Intronic
1091067086 11:132524799-132524821 GGGATCCACCTTTGGAAACTTGG + Intronic
1091283268 11:134394310-134394332 GGTGTCCTCACATGCAAAATGGG - Intronic
1091800770 12:3323268-3323290 GGGGACCTCACTGGGAAATAGGG + Intergenic
1092659326 12:10722408-10722430 GGGGTCCTTGCTTGGGATCTGGG - Intronic
1094615404 12:32031945-32031967 TGGGTCCTAAATTGGAAGCTGGG + Intergenic
1099743736 12:86675152-86675174 GGGGTCATCTCTTGGGTACTAGG - Intronic
1100131380 12:91498502-91498524 AGGGCGCTCACTTGGAATCTGGG + Intergenic
1100336666 12:93637570-93637592 AGTGTTCTCACCTGGAAACTGGG + Intergenic
1103592219 12:122000194-122000216 GGCATCCTCACTTGTAAAATGGG + Intronic
1104391254 12:128392279-128392301 CAGTTCCTCACTTGTAAACTCGG - Intronic
1105025233 12:132844016-132844038 GGGCTCCTTACCTGGCAACTCGG + Exonic
1107978454 13:45713021-45713043 GGGGTCCTCACAAGGAAATGTGG - Intronic
1108209259 13:48121856-48121878 TGAGTCCACATTTGGAAACTGGG + Intergenic
1108526365 13:51288844-51288866 GGGTTCCTCATTTGCAAAGTGGG + Intergenic
1111626302 13:90792363-90792385 GGGGTCCTAATTAGGAAAGTTGG + Intergenic
1111780445 13:92716949-92716971 AGTATCCTCACTTGGAAAATAGG - Intronic
1111973598 13:94942425-94942447 AGTGTCCTCACCTGTAAACTTGG - Intergenic
1117485294 14:56190925-56190947 TGTGTCCTCACTTAGAAAATTGG + Intronic
1119919631 14:78434461-78434483 TGTGTCCTTACTTGGAAACATGG - Intronic
1120731591 14:88008917-88008939 GGGGTCCTCACTTGGAAACTAGG - Intronic
1121666020 14:95672987-95673009 GAGGTCCCCACTTTGAAACTAGG - Intergenic
1122998211 14:105276931-105276953 GGGGCCCTCACTAGGGAGCTGGG + Intronic
1122998264 14:105277143-105277165 GGGGCCCTCACTAGGGAGCTGGG + Intronic
1202937072 14_KI270725v1_random:99305-99327 GGGTTCCTCACTGGGAACGTGGG + Intergenic
1124637524 15:31374496-31374518 AGGGACCTCACTTTGGAACTGGG - Exonic
1124891783 15:33740443-33740465 GGGGTCCTCACTGGAAAAGCTGG + Intronic
1125757627 15:42074269-42074291 GGGTTACTTGCTTGGAAACTGGG - Intronic
1127268833 15:57382794-57382816 GGGGTCCTCACTTGGAAAATGGG - Intronic
1127969874 15:63949820-63949842 GGGTCCCTCACTTGCAAAATGGG + Intronic
1133832830 16:9339955-9339977 AGTGTCCTCATTTGGAAAGTGGG + Intergenic
1135402655 16:22176985-22177007 GGTTTCCTCACATGGAAAATGGG - Intronic
1136901591 16:34045085-34045107 GGGTTCCTCACTGGGAACGTGGG - Intergenic
1138242237 16:55436380-55436402 AGGGTCCTCATTTGGAAAATGGG - Intronic
1138488041 16:57359238-57359260 GGGGTTCTCCCTTGGAAAGCTGG + Intronic
1140022264 16:71249623-71249645 GGGTTCCTCATTTGTAAACTGGG - Intergenic
1140635015 16:76902135-76902157 GGGGTCCTGTCCCGGAAACTAGG + Intergenic
1140752267 16:78035843-78035865 GTGGTTGTCACCTGGAAACTGGG + Intronic
1142581648 17:946773-946795 AGTGTCCTCACCTGGAAAATGGG + Intronic
1143365432 17:6405450-6405472 GGTTTCCTCATCTGGAAACTGGG + Intronic
1144201972 17:12949719-12949741 GGGGTACTCACTTGGAAGCCTGG - Exonic
1145003020 17:19318768-19318790 GGGGTTCTCACGTGGAAGCCTGG + Intronic
1145709488 17:26957490-26957512 GGGTTCCTCACTGGGAACGTGGG - Intergenic
1149424706 17:56543994-56544016 TGTGTCCTCATTTGGAAACAAGG - Intergenic
1150643829 17:66965931-66965953 GGAGACCTCAGTAGGAAACTAGG + Intronic
1151152481 17:72099781-72099803 TGGGACCTTACTTGGAAACAGGG - Intergenic
1151986908 17:77549419-77549441 GAGGTCCTAACTTGGGAACTTGG - Intergenic
1154518774 18:15203267-15203289 GGGTTCCTCACTGGGAACGTGGG + Intergenic
1155272255 18:24152343-24152365 GGCCTCCTCACTTGCAAAATGGG - Intronic
1156488003 18:37478793-37478815 GGGCTTCTCTCTTGGAACCTTGG + Intronic
1158535240 18:58302727-58302749 AGGGTCCTCATCTGGAAAATGGG - Intronic
1159024820 18:63173945-63173967 GGTTTCCTCACTTGGATAATTGG + Intronic
1162743453 19:12786318-12786340 GGGGCCCTCACTAGGAAACTGGG - Intronic
1162942843 19:14023993-14024015 GGTTTCCTCACTTGCAAAATGGG - Intergenic
1162947150 19:14050951-14050973 GGAGTCATTACTTGGAAGCTAGG + Intronic
1163496645 19:17649742-17649764 GGTGACCTTACTTGGAAACGGGG + Intronic
1163721248 19:18899204-18899226 GGGGTTCTCATTTTGAATCTTGG + Intergenic
1164050554 19:21582875-21582897 GGTCTCCTCACTTGTAAAATAGG - Intergenic
1164600915 19:29562712-29562734 GGGCTTCTCACCTGGAAAGTGGG - Intronic
1166863842 19:45824506-45824528 GGGGCCCTTACCTGGAAAATGGG - Intronic
1166991960 19:46697916-46697938 GGGGGCATCTCTGGGAAACTAGG + Intronic
926135047 2:10330620-10330642 GGTGTCCTCACAAGGAGACTGGG - Intronic
928012742 2:27625862-27625884 GGGGTCCTCTATGGGAAAATAGG - Intronic
929775071 2:44925209-44925231 GGGGAACTCAGTTTGAAACTGGG - Intergenic
933177986 2:79197386-79197408 TTGGACCTCAATTGGAAACTGGG + Intronic
935657193 2:105433627-105433649 GGCGTCCTCACCTGTAAACAAGG + Intronic
937115824 2:119404362-119404384 TGTGTCCTCACTGGGAAACCAGG - Intergenic
937304193 2:120861141-120861163 GGGTTCCTCACCTGTAAAATGGG - Intronic
938340793 2:130534887-130534909 GGTGTCCTCACTTGGCAAAAGGG - Intergenic
942681143 2:178479546-178479568 TGGGTATTCACTTGGAAACAAGG - Intergenic
946036191 2:216744221-216744243 GGTGTCTTCACTTGCAAAATGGG + Intergenic
1172479282 20:35261424-35261446 AATGTCCTCACTTGTAAACTGGG - Intronic
1175274994 20:57762325-57762347 AGGGTCCCCACTTGGATTCTCGG - Intergenic
1175857797 20:62132019-62132041 GTGGGCCTGGCTTGGAAACTTGG + Intronic
1176586241 21:8589671-8589693 GGGTTCCTCACTGGGAACGTGGG - Intergenic
1176742945 21:10622391-10622413 GGGTTCCTCACTGGGAACGTGGG - Intergenic
1180171180 21:46059190-46059212 GGTGTCCTTACTTGTAACCTTGG - Intergenic
1180269047 22:10566575-10566597 GGGTTCCTCACTGGGAACGTGGG - Intergenic
1180950051 22:19716882-19716904 TGGACCCTCAGTTGGAAACTGGG + Intronic
1181628412 22:24137013-24137035 GGGTTCCTCACCTTGAAAGTGGG + Intronic
1183472684 22:38017902-38017924 GGTTTCCTCACTTGTAAAATGGG + Intronic
1184205558 22:43000224-43000246 GGGGTCCTGACCTGGAACCCGGG - Intronic
1203289683 22_KI270735v1_random:23060-23082 GGGTTCCTCACTGGGAACGTGGG + Intergenic
953844180 3:46414197-46414219 GGGCTGCTCAGATGGAAACTGGG - Intergenic
954949107 3:54453383-54453405 TGTGACCTTACTTGGAAACTGGG - Intronic
955682369 3:61515464-61515486 GGGATCCTCACTGGGAAAAGTGG - Intergenic
956560175 3:70566240-70566262 GGCTTCCTCTCTTGAAAACTTGG + Intergenic
956695864 3:71919030-71919052 GGGTTCCTCACTTGTAAAATGGG - Intergenic
958893842 3:99808690-99808712 GGGATGCTCACTTGGAACCCAGG - Intergenic
960478728 3:118162340-118162362 TGGGTCTTTACTTGGAAATTTGG + Intergenic
962615703 3:137124418-137124440 GGTGTCCTCATTTGTAAAATGGG + Intergenic
963900248 3:150726701-150726723 AGGTTCCTCACTTGTAAACTGGG + Intergenic
965661268 3:171044641-171044663 AGTGTCCTCACTTGCAAAATGGG + Intergenic
966916722 3:184588355-184588377 GGGGGCCACATTTTGAAACTAGG - Intronic
967216253 3:187213035-187213057 AGAGTCCTCACTTTCAAACTAGG + Intergenic
968959444 4:3735473-3735495 GGCCTCCTCACATGGAACCTGGG - Intergenic
969571885 4:8013907-8013929 AGGGCCCTCTCTTGGAAACACGG - Intronic
974240309 4:59238012-59238034 GGAGACCTCTCCTGGAAACTGGG + Intergenic
980482275 4:133402077-133402099 AGGGCCCTGACTGGGAAACTTGG - Intergenic
982128686 4:152206912-152206934 AGTGACCTCACTTGGAGACTCGG + Intergenic
984012579 4:174388345-174388367 GGTGTCCTCACATGGAAACCAGG - Intergenic
985731217 5:1550084-1550106 GGTGTTCTCATTTGGAAAATGGG + Intergenic
986735240 5:10663160-10663182 AGGGTCCTCATTTGTAAAGTGGG + Intergenic
986807474 5:11321985-11322007 GGGGAGCTCTGTTGGAAACTGGG + Intronic
989455406 5:41637963-41637985 GGTCTCCTCTCCTGGAAACTAGG + Intergenic
989773095 5:45168242-45168264 GGGACCCTCACCTGGACACTTGG + Intergenic
991448043 5:66721438-66721460 GTGGTCCTCACTTGGCCTCTGGG + Intronic
991474764 5:67007368-67007390 GGTGTCCTCACCTGGACACTGGG - Intronic
1001556012 5:172637700-172637722 GGTGTCCTCGTTTGGAAAATGGG + Intergenic
1001882228 5:175254363-175254385 TTGGTCCTGAGTTGGAAACTAGG + Intergenic
1003781700 6:9435461-9435483 GTGGTCCTCTTTTAGAAACTGGG + Intergenic
1003984395 6:11420237-11420259 GGGGTCCTGACTTGAAGCCTGGG - Intergenic
1006695278 6:35925792-35925814 TGTGTCCTTACTTGGAAACAGGG - Intergenic
1008198989 6:48562958-48562980 TTGATCCTCACTTGAAAACTGGG + Intergenic
1008284811 6:49636230-49636252 AGGGTCCTCACATGAAATCTAGG + Intronic
1010072870 6:71764550-71764572 GGGATTCTGACTAGGAAACTTGG - Intergenic
1017030368 6:150215799-150215821 TGGGTCCTCACCTGGGAACTGGG - Intronic
1017347918 6:153406073-153406095 GGCTTCCTCACTTGGGCACTCGG + Intergenic
1017895827 6:158679060-158679082 GTGGTCCTCCTTTGTAAACTTGG + Intronic
1018083400 6:160278202-160278224 CGGGCCCTCAGTTGGACACTGGG - Intergenic
1018124671 6:160670104-160670126 AGGTTCCTCACTTGTAAAATAGG + Intergenic
1018132697 6:160747903-160747925 AGGCTCCTCATTTGTAAACTAGG - Intronic
1018138835 6:160806599-160806621 GCCTTCCTCACTTGGACACTCGG - Intergenic
1019332030 7:464976-464998 GGGGGCCTCATTTGGTCACTGGG - Intergenic
1019777259 7:2919219-2919241 GGGGACCTCACTGTGAAACAGGG + Intronic
1022078076 7:26993129-26993151 GGGGTGCTCTCTTGGAGGCTAGG - Intronic
1022101568 7:27172553-27172575 GGGGTGCTTACTTGGAAGATGGG + Intronic
1024467098 7:49722891-49722913 GCATTCCTCTCTTGGAAACTAGG + Intergenic
1024934611 7:54699685-54699707 GGTGACCTTATTTGGAAACTGGG - Intergenic
1027641438 7:80738124-80738146 GGGGTCCTCATCTGAAAAATTGG - Intergenic
1027714549 7:81653615-81653637 GGGCTTCTCATTTGGAAAGTAGG - Intergenic
1028545671 7:91996949-91996971 GGTGTCCTCACTTAGAAAATAGG - Intronic
1028825434 7:95267555-95267577 GGGGTCCTAACTTAAAATCTAGG + Intronic
1032741122 7:134740608-134740630 GTGCTCCTCACATGGAATCTGGG + Intergenic
1033616441 7:143020736-143020758 GGGTTCCTCTTTTGGAACCTTGG - Intergenic
1034986084 7:155516407-155516429 GGGGTCCTCACTTGGGAAGTGGG - Intronic
1035341414 7:158164959-158164981 GGGGTCTTCACTTGCGACCTTGG - Intronic
1037196913 8:16201692-16201714 GGTGTCCTCAGTTTTAAACTGGG - Intronic
1037707072 8:21324188-21324210 GTGTTTCTGACTTGGAAACTGGG + Intergenic
1039472334 8:37821237-37821259 GGGTTACTCACCTGGAAAATAGG + Intronic
1043304105 8:78772694-78772716 GGGGTCTTCATTTAGAAATTTGG - Intronic
1044199875 8:89421706-89421728 GGTGTCCTGACTTGGAATTTAGG - Intergenic
1045035516 8:98173550-98173572 GGGGTCTTCCCTTGGAATCCAGG + Intergenic
1047155248 8:122310006-122310028 GGCTTCCTCACTTGCAAAATGGG - Intergenic
1047433980 8:124819082-124819104 GGGATACTCAGTGGGAAACTGGG - Intergenic
1047754838 8:127910382-127910404 GGTGTCCTCATCTGCAAACTGGG + Intergenic
1055639714 9:78310232-78310254 GGCTTCCTCACTTGCAAAATGGG - Intronic
1057136070 9:92688762-92688784 GGGCTCCTGAGTGGGAAACTGGG + Intergenic
1057334247 9:94143332-94143354 GTGGTCCCCACTTGGAAAGTGGG + Intergenic
1062172633 9:135144000-135144022 GGTGGCCTTATTTGGAAACTGGG - Intergenic
1062459713 9:136657807-136657829 GGGGTCCCCAGATGGACACTGGG - Intergenic
1203582117 Un_KI270746v1:18091-18113 GGGTTCCTCACTGGGAACGTGGG - Intergenic
1203616149 Un_KI270749v1:67186-67208 GGGTTCCTCACTGGGAACGTGGG - Intergenic
1192986055 X:76399313-76399335 GGGGTCACCACTGGGCAACTTGG - Intergenic
1198618438 X:138482103-138482125 AGGATCCTCACTTGGACTCTTGG - Intergenic
1199947218 X:152679482-152679504 AGGGTCCTCACCTTGAAACCTGG - Intergenic
1199962462 X:152788972-152788994 AGGGTCCTCACCTTGAAACCTGG + Intergenic