ID: 1120734072

View in Genome Browser
Species Human (GRCh38)
Location 14:88034002-88034024
Sequence AACTTGTATTAGGAATATTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120734072_1120734078 3 Left 1120734072 14:88034002-88034024 CCCAAATATTCCTAATACAAGTT No data
Right 1120734078 14:88034028-88034050 GGTCCCACTCTTTTCCCATCAGG No data
1120734072_1120734079 4 Left 1120734072 14:88034002-88034024 CCCAAATATTCCTAATACAAGTT No data
Right 1120734079 14:88034029-88034051 GTCCCACTCTTTTCCCATCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120734072 Original CRISPR AACTTGTATTAGGAATATTT GGG (reversed) Intergenic
No off target data available for this crispr