ID: 1120736373

View in Genome Browser
Species Human (GRCh38)
Location 14:88057560-88057582
Sequence ATACAGATCCCCAGGGAAGC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120736368_1120736373 8 Left 1120736368 14:88057529-88057551 CCCTGGGGGATTATGGCTGCTCT No data
Right 1120736373 14:88057560-88057582 ATACAGATCCCCAGGGAAGCGGG No data
1120736360_1120736373 30 Left 1120736360 14:88057507-88057529 CCCAGGCCAATGGAGTTATGTTC 0: 43
1: 94
2: 142
3: 185
4: 328
Right 1120736373 14:88057560-88057582 ATACAGATCCCCAGGGAAGCGGG No data
1120736363_1120736373 24 Left 1120736363 14:88057513-88057535 CCAATGGAGTTATGTTCCCTGGG No data
Right 1120736373 14:88057560-88057582 ATACAGATCCCCAGGGAAGCGGG No data
1120736369_1120736373 7 Left 1120736369 14:88057530-88057552 CCTGGGGGATTATGGCTGCTCTG 0: 2
1: 0
2: 1
3: 33
4: 363
Right 1120736373 14:88057560-88057582 ATACAGATCCCCAGGGAAGCGGG No data
1120736361_1120736373 29 Left 1120736361 14:88057508-88057530 CCAGGCCAATGGAGTTATGTTCC 0: 39
1: 97
2: 143
3: 178
4: 343
Right 1120736373 14:88057560-88057582 ATACAGATCCCCAGGGAAGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120736373 Original CRISPR ATACAGATCCCCAGGGAAGC GGG Intergenic
No off target data available for this crispr