ID: 1120737394

View in Genome Browser
Species Human (GRCh38)
Location 14:88068265-88068287
Sequence GTTTACTTACCATAAAAGAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120737390_1120737394 29 Left 1120737390 14:88068213-88068235 CCCTCGTTTATTTAAAAACAACA No data
Right 1120737394 14:88068265-88068287 GTTTACTTACCATAAAAGACTGG No data
1120737392_1120737394 -3 Left 1120737392 14:88068245-88068267 CCAGTGTAAATAAAAAACCAGTT No data
Right 1120737394 14:88068265-88068287 GTTTACTTACCATAAAAGACTGG No data
1120737391_1120737394 28 Left 1120737391 14:88068214-88068236 CCTCGTTTATTTAAAAACAACAT No data
Right 1120737394 14:88068265-88068287 GTTTACTTACCATAAAAGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120737394 Original CRISPR GTTTACTTACCATAAAAGAC TGG Intergenic
No off target data available for this crispr