ID: 1120738384

View in Genome Browser
Species Human (GRCh38)
Location 14:88080427-88080449
Sequence CATTATGTATACAAATTGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120738384_1120738391 23 Left 1120738384 14:88080427-88080449 CCTCCCAATTTGTATACATAATG No data
Right 1120738391 14:88080473-88080495 AGTAAATGGTTTTTGTTTTGGGG No data
1120738384_1120738387 -8 Left 1120738384 14:88080427-88080449 CCTCCCAATTTGTATACATAATG No data
Right 1120738387 14:88080442-88080464 ACATAATGACTAAGTTTCATTGG No data
1120738384_1120738388 9 Left 1120738384 14:88080427-88080449 CCTCCCAATTTGTATACATAATG No data
Right 1120738388 14:88080459-88080481 CATTGGCTTGCATAAGTAAATGG No data
1120738384_1120738389 21 Left 1120738384 14:88080427-88080449 CCTCCCAATTTGTATACATAATG No data
Right 1120738389 14:88080471-88080493 TAAGTAAATGGTTTTTGTTTTGG No data
1120738384_1120738390 22 Left 1120738384 14:88080427-88080449 CCTCCCAATTTGTATACATAATG No data
Right 1120738390 14:88080472-88080494 AAGTAAATGGTTTTTGTTTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120738384 Original CRISPR CATTATGTATACAAATTGGG AGG (reversed) Intergenic
No off target data available for this crispr