ID: 1120738457

View in Genome Browser
Species Human (GRCh38)
Location 14:88081118-88081140
Sequence CTGAGCCATGCAAAGATGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120738457_1120738458 0 Left 1120738457 14:88081118-88081140 CCTTTCATCTTTGCATGGCTCAG No data
Right 1120738458 14:88081141-88081163 AGATAAAATTATTCTGAGCCTGG No data
1120738457_1120738461 29 Left 1120738457 14:88081118-88081140 CCTTTCATCTTTGCATGGCTCAG No data
Right 1120738461 14:88081170-88081192 TGCCCTGTGGTTTCTGCTCATGG No data
1120738457_1120738459 16 Left 1120738457 14:88081118-88081140 CCTTTCATCTTTGCATGGCTCAG No data
Right 1120738459 14:88081157-88081179 AGCCTGGATCTCATGCCCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120738457 Original CRISPR CTGAGCCATGCAAAGATGAA AGG (reversed) Intergenic
No off target data available for this crispr