ID: 1120743904

View in Genome Browser
Species Human (GRCh38)
Location 14:88136865-88136887
Sequence CTCGGTTATAACTTCATCAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 93
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 86}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120743904_1120743906 -6 Left 1120743904 14:88136865-88136887 CCATTGATGAAGTTATAACCGAG 0: 1
1: 0
2: 0
3: 6
4: 86
Right 1120743906 14:88136882-88136904 ACCGAGAACACAATTTGGATCGG 0: 1
1: 0
2: 0
3: 9
4: 68
1120743904_1120743911 23 Left 1120743904 14:88136865-88136887 CCATTGATGAAGTTATAACCGAG 0: 1
1: 0
2: 0
3: 6
4: 86
Right 1120743911 14:88136911-88136933 GTTTGGCCAAGCTGAGTTCCAGG 0: 1
1: 0
2: 0
3: 9
4: 163
1120743904_1120743912 24 Left 1120743904 14:88136865-88136887 CCATTGATGAAGTTATAACCGAG 0: 1
1: 0
2: 0
3: 6
4: 86
Right 1120743912 14:88136912-88136934 TTTGGCCAAGCTGAGTTCCAGGG 0: 1
1: 0
2: 0
3: 12
4: 207
1120743904_1120743910 6 Left 1120743904 14:88136865-88136887 CCATTGATGAAGTTATAACCGAG 0: 1
1: 0
2: 0
3: 6
4: 86
Right 1120743910 14:88136894-88136916 ATTTGGATCGGAGGCAGGTTTGG 0: 1
1: 0
2: 0
3: 4
4: 82
1120743904_1120743908 -3 Left 1120743904 14:88136865-88136887 CCATTGATGAAGTTATAACCGAG 0: 1
1: 0
2: 0
3: 6
4: 86
Right 1120743908 14:88136885-88136907 GAGAACACAATTTGGATCGGAGG 0: 1
1: 0
2: 0
3: 3
4: 55
1120743904_1120743909 1 Left 1120743904 14:88136865-88136887 CCATTGATGAAGTTATAACCGAG 0: 1
1: 0
2: 0
3: 6
4: 86
Right 1120743909 14:88136889-88136911 ACACAATTTGGATCGGAGGCAGG 0: 1
1: 0
2: 0
3: 3
4: 61

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120743904 Original CRISPR CTCGGTTATAACTTCATCAA TGG (reversed) Intergenic
907620608 1:55974384-55974406 CTGGGTTCAAACTTCATCACAGG + Intergenic
908819481 1:68069038-68069060 CTCTGTTATAACTCCACCGAAGG - Intergenic
916427288 1:164692852-164692874 CTAGGTTCTAATTTCATGAAAGG + Intronic
917718064 1:177758089-177758111 TTCGGATACAAATTCATCAAAGG + Intergenic
921633970 1:217470006-217470028 CTGGGTTATAACTTCATTATGGG - Intronic
1062949352 10:1485925-1485947 CTCTCTTCTAACTTCATCATTGG + Intronic
1063927527 10:10995120-10995142 CTTGGTTATAAGTTCCTTAAGGG + Intergenic
1064104703 10:12491113-12491135 CTTGGTTGTAACTGCATCACTGG + Intronic
1070505192 10:77106846-77106868 CTTGGTTCTAACCTCATCCAGGG + Intronic
1078493620 11:11793805-11793827 CTAGGTTGTAAATTCCTCAAAGG - Intergenic
1079050069 11:17146953-17146975 TTCGATTTTAAGTTCATCAAGGG + Intronic
1079515195 11:21259214-21259236 CTAGATTATAACATCCTCAAGGG - Intronic
1080128096 11:28761381-28761403 CTCTGTTAGAACTCCAGCAAAGG - Intergenic
1087591291 11:100191612-100191634 CTCTGTTATCACTTCAACTAGGG + Intronic
1088587056 11:111368574-111368596 GCAGGTTATGACTTCATCAAGGG - Intronic
1091061853 11:132471139-132471161 CTCGGCTGAAACTTTATCAAGGG - Intronic
1094212202 12:27904534-27904556 CTCAGTTATAACTTTTGCAAAGG + Intergenic
1098626364 12:72675317-72675339 CTAGATTATAAATTCTTCAAGGG + Intergenic
1100056364 12:90516162-90516184 TGCGGTTTAAACTTCATCAAGGG - Intergenic
1100272785 12:93042371-93042393 CTCGGTTATAAGCTCCTCAAAGG - Intergenic
1104401394 12:128479536-128479558 CTCTGATAAAACTTTATCAATGG - Intronic
1105348714 13:19597429-19597451 CTCGGTTATAATTTTTGCAAAGG - Intergenic
1106822724 13:33484059-33484081 CACTGTTATAACTTCTGCAAAGG - Intergenic
1108569302 13:51733513-51733535 CTCTGTTTAAACTTCATCACTGG - Intronic
1109912611 13:68934732-68934754 CTCAGTTATAACTTTTGCAAAGG + Intergenic
1117012054 14:51481213-51481235 CTCGGGTATATCTTTATCAGCGG - Intergenic
1117243926 14:53864491-53864513 CTCGGTTGTAATCTCTTCAATGG - Intergenic
1120743904 14:88136865-88136887 CTCGGTTATAACTTCATCAATGG - Intergenic
1127164796 15:56233112-56233134 CTCGGGTATGTCTTTATCAACGG - Intronic
1134740551 16:16539959-16539981 CTCAGTTATAATTTCTGCAAAGG - Intergenic
1134926953 16:18172213-18172235 CTCAGTTATAATTTCTGCAAAGG + Intergenic
1135186285 16:20318663-20318685 CTCAGTTATTCCTTCAGCAAGGG - Intronic
1137749404 16:50848093-50848115 CTGAGTTATAACTTCTTAAATGG + Intergenic
1149335744 17:55633924-55633946 CTCTTTTATAACTGCATTAATGG + Intergenic
1151498712 17:74475031-74475053 CTCGGGTATGTCTTTATCAACGG - Intronic
1155669380 18:28350493-28350515 CTCAGTTATAATTTCTGCAAAGG - Intergenic
1155750077 18:29412021-29412043 CTCTGTGATACCTTCACCAAAGG - Intergenic
1158558022 18:58491116-58491138 CTCAGTTATAATTTCTGCAAAGG - Intronic
1160982321 19:1822084-1822106 CTGGTTTGTGACTTCATCAAAGG - Intronic
1165117476 19:33537591-33537613 CTCGGTTATGTCTTTATCAGCGG - Intergenic
1167737738 19:51306980-51307002 CTCTATTAGAACTTTATCAATGG + Intergenic
926965517 2:18405686-18405708 CTGGGTTATGAAATCATCAAGGG - Intergenic
939311131 2:140478502-140478524 CTCAGTTATCACTTTATCAGGGG - Intronic
941062511 2:160864187-160864209 CTAGGTTATAACTTCACCTTTGG - Intergenic
947425168 2:229976855-229976877 CTTGATTTTAACTTCATTAATGG - Intronic
948302455 2:236917960-236917982 CTCGGTTATAATTTTTGCAAAGG + Intergenic
1169033719 20:2432860-2432882 CTCGGTTCTTACATCATCTATGG - Intergenic
1178241249 21:30903612-30903634 CTCAGTTATAACTTTTGCAAAGG - Intergenic
957623665 3:82629278-82629300 CTAGCTTATAACTTCTTCAGAGG - Intergenic
957827383 3:85466309-85466331 GTGGGTTATAATTTGATCAAAGG + Intronic
959130573 3:102351066-102351088 CTAGGTTATGAATTCATCAGGGG - Intronic
959855166 3:111145341-111145363 TTCGGTTACCACTTCATGAAAGG - Intronic
960553290 3:119000872-119000894 CTCGGTTGTAATCTCTTCAATGG + Intronic
960840831 3:121956912-121956934 CTCTGATATAGCTTCATGAAGGG - Intergenic
972027295 4:34398906-34398928 CTCTGTTAAAAATTCCTCAATGG - Intergenic
974031414 4:56780116-56780138 CTGGGCTATAAACTCATCAATGG + Intergenic
977305582 4:95319407-95319429 CTCATTTCTAATTTCATCAAAGG - Intronic
979297812 4:119052985-119053007 ATGGGTTATATCATCATCAAGGG - Intronic
980859745 4:138485011-138485033 CTCGGTTTTGACTTCCTCAAGGG + Intergenic
987486572 5:18533864-18533886 CTCGGTTATAATTTTTGCAAAGG + Intergenic
988964872 5:36405912-36405934 CTCTGTTTTAAATTCTTCAACGG + Intergenic
989084589 5:37662138-37662160 CTCGGTTATAATTTTTGCAAAGG + Intronic
992957629 5:81926539-81926561 CTCAGTTATATATTCAACAATGG - Intergenic
997479352 5:134172220-134172242 CTAGTTTATAAATTCTTCAAGGG + Intronic
1001536918 5:172504511-172504533 CTCAGTAATGACTTCTTCAATGG - Intergenic
1002915126 6:1522843-1522865 CTCGGTTGAAACTTCCTCACTGG + Intergenic
1005082220 6:21967774-21967796 CTCAGTTATCACTTGAACAAAGG + Intergenic
1008465364 6:51824249-51824271 CTAGGTAATCAGTTCATCAAGGG + Intronic
1010329643 6:74608222-74608244 CTCGGTTAGTTCTTCCTCAAAGG + Intergenic
1013148046 6:107414455-107414477 CTAGGCTATAACTTCAGAAAAGG + Intronic
1014579938 6:123124569-123124591 CTCTGTTATATCTTCATCAGTGG + Intergenic
1015152107 6:130051784-130051806 CTCGGTTAAAACTCCACCTACGG + Intronic
1025948672 7:66125344-66125366 CTCGTTTAGGACTTCATAAAAGG + Intronic
1031298279 7:120033032-120033054 CTGGGGTATGCCTTCATCAAAGG + Intergenic
1035848561 8:2891169-2891191 GTCTGTTAAAACTTCATAAATGG - Intergenic
1042805509 8:72766843-72766865 CTTGGGTATATCTTTATCAATGG - Intronic
1047995299 8:130329317-130329339 CTTTGTTGTATCTTCATCAAGGG - Intronic
1050867489 9:10521249-10521271 CTCTGTAGTAACTTCATCCATGG - Intronic
1051816122 9:21107367-21107389 CTAGATTATAACTTCTTCAATGG - Intergenic
1052054081 9:23883588-23883610 CTCGGGTATATCTTTATCAGCGG - Intergenic
1054800507 9:69343733-69343755 CAAGGTAATAATTTCATCAATGG + Intronic
1056656333 9:88512484-88512506 CTCAGTTATAATTTCTGCAAAGG + Intergenic
1057523722 9:95781660-95781682 CGTGGTTATAACTTCATAAAGGG + Intergenic
1058332635 9:103782876-103782898 GTGGGTAATAACTTCCTCAATGG - Intergenic
1058811366 9:108642831-108642853 TTAGGTTATACCTTCACCAAGGG + Intergenic
1187534805 X:20131180-20131202 GTCCCTTATAACCTCATCAAAGG - Intronic
1188179735 X:27039957-27039979 CTCAGTTATAATTTTTTCAAAGG - Intergenic
1188240313 X:27779159-27779181 CTAAATTATAACTTTATCAATGG - Intergenic
1188751117 X:33906812-33906834 CTCAGTTATAATTTTTTCAAAGG - Intergenic
1193523476 X:82559754-82559776 CTCAGTTATAATTTTTTCAAAGG - Intergenic
1194341773 X:92714398-92714420 CTCAGTTATAATTTTTTCAAAGG + Intergenic
1199439278 X:147849925-147849947 CTTTGTTATAGTTTCATCAAGGG - Intergenic
1200650120 Y:5831091-5831113 CTCAGTTATAATTTTTTCAAAGG + Intergenic