ID: 1120748460

View in Genome Browser
Species Human (GRCh38)
Location 14:88175005-88175027
Sequence GCAGAATAGTGGGCCTGCTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120748460_1120748471 12 Left 1120748460 14:88175005-88175027 CCACAGCAGGCCCACTATTCTGC No data
Right 1120748471 14:88175040-88175062 TCCTCTTTGCCTAAGAGGGGAGG No data
1120748460_1120748469 8 Left 1120748460 14:88175005-88175027 CCACAGCAGGCCCACTATTCTGC No data
Right 1120748469 14:88175036-88175058 CCTTTCCTCTTTGCCTAAGAGGG No data
1120748460_1120748467 7 Left 1120748460 14:88175005-88175027 CCACAGCAGGCCCACTATTCTGC No data
Right 1120748467 14:88175035-88175057 CCCTTTCCTCTTTGCCTAAGAGG No data
1120748460_1120748470 9 Left 1120748460 14:88175005-88175027 CCACAGCAGGCCCACTATTCTGC No data
Right 1120748470 14:88175037-88175059 CTTTCCTCTTTGCCTAAGAGGGG No data
1120748460_1120748474 21 Left 1120748460 14:88175005-88175027 CCACAGCAGGCCCACTATTCTGC No data
Right 1120748474 14:88175049-88175071 CCTAAGAGGGGAGGCAGATTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120748460 Original CRISPR GCAGAATAGTGGGCCTGCTG TGG (reversed) Intergenic
No off target data available for this crispr