ID: 1120751242

View in Genome Browser
Species Human (GRCh38)
Location 14:88200442-88200464
Sequence AATTAGGTACACACGTAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 63
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 58}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120751242_1120751247 10 Left 1120751242 14:88200442-88200464 CCCAGCTACGTGTGTACCTAATT 0: 1
1: 0
2: 0
3: 4
4: 58
Right 1120751247 14:88200475-88200497 TAAAAAGAAAATGGAGAGAAGGG 0: 1
1: 1
2: 19
3: 326
4: 2964
1120751242_1120751248 17 Left 1120751242 14:88200442-88200464 CCCAGCTACGTGTGTACCTAATT 0: 1
1: 0
2: 0
3: 4
4: 58
Right 1120751248 14:88200482-88200504 AAAATGGAGAGAAGGGAGAAAGG 0: 1
1: 1
2: 27
3: 275
4: 2311
1120751242_1120751246 9 Left 1120751242 14:88200442-88200464 CCCAGCTACGTGTGTACCTAATT 0: 1
1: 0
2: 0
3: 4
4: 58
Right 1120751246 14:88200474-88200496 ATAAAAAGAAAATGGAGAGAAGG 0: 1
1: 0
2: 16
3: 313
4: 3167
1120751242_1120751245 1 Left 1120751242 14:88200442-88200464 CCCAGCTACGTGTGTACCTAATT 0: 1
1: 0
2: 0
3: 4
4: 58
Right 1120751245 14:88200466-88200488 TTTCAGAGATAAAAAGAAAATGG 0: 1
1: 0
2: 11
3: 222
4: 1894
1120751242_1120751249 18 Left 1120751242 14:88200442-88200464 CCCAGCTACGTGTGTACCTAATT 0: 1
1: 0
2: 0
3: 4
4: 58
Right 1120751249 14:88200483-88200505 AAATGGAGAGAAGGGAGAAAGGG 0: 1
1: 2
2: 22
3: 292
4: 2190

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120751242 Original CRISPR AATTAGGTACACACGTAGCT GGG (reversed) Intronic
905188837 1:36217165-36217187 AATTAACTACACACTTAACTAGG + Intergenic
906751300 1:48264431-48264453 ACATAGGTACACACGTACCATGG + Intergenic
908906910 1:69024692-69024714 AATTAAGTGCACACGTATTTAGG + Intergenic
919065779 1:192691469-192691491 AACTATGTACATATGTAGCTAGG - Intergenic
1068731652 10:60364621-60364643 ACTTAGGTATACACGTACCATGG - Intronic
1071746963 10:88432142-88432164 AATTAGGTATACATGTATTTAGG + Intronic
1072372860 10:94783038-94783060 AAATAGGTACACACGTGCCATGG - Intronic
1076257341 10:129038158-129038180 AATAATGTACACAAGGAGCTTGG + Intergenic
1077205652 11:1342348-1342370 AATTCAGTACACCCGGAGCTTGG + Intergenic
1078376942 11:10803462-10803484 CATCAGCTACACACGTACCTTGG + Exonic
1088222236 11:107581341-107581363 AATTAAGTTCACACGAAGGTTGG - Intergenic
1092088110 12:5782124-5782146 TATTAGGTACACACATATTTAGG + Intronic
1094290820 12:28847683-28847705 AAATAGGTAGACAGGTAGGTAGG - Intergenic
1095922391 12:47544055-47544077 AAAGAGGCACATACGTAGCTTGG + Intergenic
1111730341 13:92067545-92067567 AATTACCTACACATGTTGCTTGG - Intronic
1112655025 13:101442980-101443002 AACTAGGCACACACGTAACTAGG - Intergenic
1117830872 14:59748417-59748439 AATTAGGTATATAGGTATCTAGG - Intronic
1120751242 14:88200442-88200464 AATTAGGTACACACGTAGCTGGG - Intronic
1126866954 15:52947279-52947301 AATTAAGCACACAAATAGCTTGG - Intergenic
1128652265 15:69426603-69426625 CCTCAGGTACACAAGTAGCTGGG - Intronic
1135245718 16:20855314-20855336 AATTAAGCACAGACGGAGCTGGG + Exonic
1138620238 16:58205382-58205404 AATGAGGTACACAGGCAGTTGGG + Intergenic
1140682834 16:77402094-77402116 AATTAGGTAGGTAGGTAGCTAGG - Intronic
1141031201 16:80590440-80590462 ACTTAGGTACACACGTGCCATGG - Intergenic
1150512490 17:65771345-65771367 AATTAGGTACATACATATTTAGG - Intronic
1158061014 18:53341559-53341581 AATTACATACACACATAGATAGG + Intronic
1160539906 18:79614875-79614897 TTTCAGGTACAGACGTAGCTGGG - Intergenic
1161803579 19:6429660-6429682 AACTAGTTACCCACGTTGCTGGG - Intronic
1164596722 19:29534977-29534999 TATTAGGTACACATGTGGCATGG - Intronic
925220222 2:2133310-2133332 AATTAGGGACACACGGAACAAGG + Intronic
927257580 2:21053627-21053649 AAGTAGGTAAACAAGAAGCTGGG + Intergenic
931264850 2:60651670-60651692 AATTAGGTACCCAGCTAGGTGGG + Intergenic
941314268 2:163973073-163973095 AATTAGGGATACACTTAGTTTGG - Intergenic
945597568 2:211813751-211813773 AATTAAGTACTCAAGTAGCAAGG - Intronic
1169550067 20:6693270-6693292 AAATAGGTATACAAATAGCTGGG + Intergenic
1184622245 22:45689902-45689924 AGGTAGTTACACACGTACCTTGG + Exonic
952362845 3:32647975-32647997 AATTAGGGTCACATGTAGCCAGG + Intergenic
952677265 3:36048378-36048400 ACGTAGGTACACACGTACCATGG + Intergenic
959875639 3:111379429-111379451 AATTAGGTAAACACGTGCCATGG - Intronic
959983104 3:112540212-112540234 ATTTAGGAACAGACATAGCTAGG + Intronic
967262818 3:187660851-187660873 GATTAGGAACACACGGGGCTGGG - Intergenic
974628839 4:64457544-64457566 AAGTATGTACACACCTGGCTGGG - Intergenic
977101624 4:92823131-92823153 AATTATGTACAAAAGTATCTTGG + Intronic
980599926 4:135009273-135009295 CATTAGGCTCCCACGTAGCTGGG + Intergenic
982525709 4:156475198-156475220 AATTTGTTACACAAGTAGGTAGG - Intergenic
985169442 4:187133090-187133112 AAATAGGTATACATGTAGGTAGG - Intergenic
1004412804 6:15397063-15397085 AATTAGGTACACACACAGTCTGG - Intronic
1011717186 6:90119289-90119311 AATTAGGTAAAGACAGAGCTGGG - Intronic
1012589997 6:100969164-100969186 AAGTAGGTAAACAAGCAGCTGGG + Intergenic
1017968108 6:159284568-159284590 ACATAGGTATACACGTGGCTTGG + Intergenic
1029838775 7:103340584-103340606 AATGAGGTACACACATATCTGGG + Intronic
1035530900 8:350181-350203 AATTAGGTAGGCAGGTAGATAGG + Intergenic
1035530973 8:350610-350632 AGTCAGGTACACAGGTAGGTAGG + Intergenic
1035531035 8:351007-351029 AAGTAGGTACATAGGTAGGTAGG + Intergenic
1036130909 8:6109220-6109242 ATTTACGTACACAAGGAGCTTGG + Intergenic
1041566802 8:59287529-59287551 AATTAGATGCACAGGAAGCTGGG + Intergenic
1045934646 8:107664702-107664724 AAGAAGATACAAACGTAGCTGGG + Intergenic
1054830548 9:69620301-69620323 TATAAGGTACACACTAAGCTAGG + Intronic
1054845451 9:69791884-69791906 AATTATGTAAACACGTAGTTGGG + Intergenic
1061002620 9:127910833-127910855 AAATAGATAAACAAGTAGCTAGG + Intronic
1185484028 X:468694-468716 TTTTAGGTACATACTTAGCTGGG - Intergenic
1187193774 X:17061276-17061298 AATTAGATAGACACGTAGGTAGG + Intronic
1191123473 X:56929789-56929811 CATCAGGTAAACACGTACCTTGG + Intergenic