ID: 1120755971

View in Genome Browser
Species Human (GRCh38)
Location 14:88244689-88244711
Sequence CACTTCTGCAGCCTGAATGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 219
Summary {0: 1, 1: 0, 2: 0, 3: 26, 4: 192}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120755971_1120755977 26 Left 1120755971 14:88244689-88244711 CCTGCATTCAGGCTGCAGAAGTG 0: 1
1: 0
2: 0
3: 26
4: 192
Right 1120755977 14:88244738-88244760 TGAGCACACAGATGATGAAATGG 0: 1
1: 0
2: 3
3: 36
4: 346

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120755971 Original CRISPR CACTTCTGCAGCCTGAATGC AGG (reversed) Intronic
901018935 1:6246183-6246205 CACTTTTGCAGCCTTCAAGCTGG - Intergenic
902333055 1:15740077-15740099 CAGTTCTGGAGGCTGGATGCTGG + Exonic
903068525 1:20715008-20715030 CTCACCTGCAGCCTGGATGCCGG + Intronic
903355807 1:22746722-22746744 GACTTCTGCATCCTGAAAGGTGG - Intronic
903631437 1:24776005-24776027 CAGTTTTGCAGCTTGAATTCAGG - Intronic
904423964 1:30411495-30411517 TACTTCTGCAGACTGAGTTCAGG - Intergenic
905001137 1:34671128-34671150 CCCTGCTGCAGCCTGCATGATGG - Intergenic
905353475 1:37364013-37364035 CACTTCTCCAGCCTTAAGTCTGG - Intergenic
905359457 1:37409194-37409216 GAGTTCAGCAGCCTGAGTGCTGG - Intergenic
907637186 1:56147209-56147231 CACATCTGCAGGCTGAGTTCAGG + Intergenic
910916931 1:92299168-92299190 CACTTTTGGACCCTGAAAGCTGG + Intronic
912273806 1:108236015-108236037 CACCTCTGCAGCCTGGGTGCAGG - Intronic
912294413 1:108458308-108458330 CACCTCTGCAGCCTGGGTGCAGG + Intronic
912930179 1:113951339-113951361 CAATTCTGGAGCCAGATTGCAGG + Intronic
912967523 1:114249268-114249290 CAATGCTGCAGTCTGAATGGCGG + Intergenic
913427840 1:118754457-118754479 CACTGCTGAAACATGAATGCTGG - Intergenic
914730105 1:150362605-150362627 CACTTCGGGAGGCTGAAAGCAGG + Intergenic
916081479 1:161235873-161235895 CACTTCTGCAACCTGCAGGCTGG + Exonic
918448391 1:184636156-184636178 CAATTCTGCTGCCGAAATGCCGG + Intergenic
919838283 1:201591606-201591628 CAGTTCTGCAGCCTGCTGGCTGG + Intergenic
920509940 1:206543476-206543498 GAATTGTGCAGCATGAATGCAGG + Intronic
921077323 1:211710617-211710639 CACTTCTTCAGGCTGAATAGCGG - Intergenic
922647438 1:227303349-227303371 TACTTCTGCTCCCAGAATGCTGG - Intronic
1063581198 10:7309223-7309245 ACCTTCTCCTGCCTGAATGCTGG + Intronic
1063690008 10:8278159-8278181 CACTTCTGCAGACAGAAGACGGG - Intergenic
1064727775 10:18298636-18298658 CACTACTCCAGCCTTAGTGCAGG + Intronic
1065477120 10:26151790-26151812 CACTTCTCCAGGCAGAAAGCTGG + Intronic
1065950294 10:30645378-30645400 CACTGCCGCATCCTGAACGCAGG - Intergenic
1066538700 10:36420759-36420781 CTCTCCTGCATCCTTAATGCAGG + Intergenic
1067508570 10:46876810-46876832 CACTTCTCCAGGCTGCATGGAGG + Intergenic
1067653678 10:48175039-48175061 CACTTCTCCAGGCTGCATGGAGG - Intronic
1069417101 10:68210218-68210240 CACCTCTGCAGCGTACATGCTGG + Intronic
1071011022 10:80940826-80940848 AACATCTGCAGCCTGAAGCCTGG + Intergenic
1074221737 10:111444808-111444830 CACTTCTCCAGCCTGAGTCCTGG + Intergenic
1075870306 10:125767928-125767950 CACTGCTGCAGTTGGAATGCTGG + Intronic
1076151170 10:128163059-128163081 CACCTCTTCAGCCGGCATGCTGG + Intergenic
1077033794 11:483970-483992 CACTGGTGCAGCCTGCATGGAGG + Intronic
1078753849 11:14190232-14190254 CACTCCAGGAGCCTGAAAGCAGG + Intronic
1079089868 11:17473398-17473420 CACTGCTGAAGCCAGGATGCAGG + Intronic
1079275291 11:19029955-19029977 CACTTCTGCAGCCTACCTGCTGG - Intergenic
1081612431 11:44570625-44570647 CACTTCTGCAACCTGGATCCAGG + Intronic
1083918545 11:65766710-65766732 CAATGCTTCAGCCTGAATGCTGG - Intergenic
1084565616 11:69926820-69926842 AGACTCTGCAGCCTGAATGCTGG - Intergenic
1084647545 11:70467247-70467269 AACTTCTGCGGCCTGTTTGCGGG + Intergenic
1085514410 11:77103958-77103980 CACTTCTCCACCCTGAAGTCAGG - Intronic
1087275069 11:96152987-96153009 CATTTCTACAGCCAGAATGCAGG + Intronic
1088770027 11:113025391-113025413 TACTTCTGCATCATGAATGCTGG + Intronic
1088859379 11:113785570-113785592 CACTGAAGCAGCCTGAAAGCAGG + Intergenic
1089469791 11:118711462-118711484 CAGTACTGCAACATGAATGCAGG + Intergenic
1090648543 11:128786609-128786631 CACATCTGCAGCCTGGAGGACGG - Intronic
1092237652 12:6820112-6820134 CACTGCTGCCTCTTGAATGCAGG + Exonic
1092898656 12:13037947-13037969 CACTTCAGCCTCCTGAGTGCTGG - Intergenic
1093498609 12:19784302-19784324 CACTTCTGCAGCCTGGGCTCAGG - Intergenic
1095293436 12:40502352-40502374 CAGTTCTGCAGGCTGTATGGAGG + Intronic
1100138477 12:91585877-91585899 AACTGCTGCAGCCTGAATGAAGG - Intergenic
1104587056 12:130055992-130056014 CACTGCTGCACCCTCCATGCCGG - Intergenic
1105041697 12:132966437-132966459 CGCTGCTGCAGCCTGCATGATGG - Intergenic
1106620118 13:31364708-31364730 CCCTGCTGCAGCCGGAATGATGG - Intergenic
1112230919 13:97588715-97588737 CACTTCTGCCCCCTGATTCCAGG + Intergenic
1112880886 13:104104981-104105003 CTGTTCTGTAGCCTGAAAGCTGG + Intergenic
1113642718 13:111969685-111969707 CTCTTCTGCAGCCTTCATCCAGG - Intergenic
1117690760 14:58302707-58302729 CACTTGGGAAGCCTGAATGGGGG + Intronic
1120755971 14:88244689-88244711 CACTTCTGCAGCCTGAATGCAGG - Intronic
1121644798 14:95510441-95510463 CACTTCTGCAGAGGGAAGGCAGG + Intergenic
1122201130 14:100123434-100123456 CTCTTCTGCAGCCAGAAGGTGGG + Intronic
1124103143 15:26713798-26713820 CACTTCTGCCTCCTTACTGCAGG + Intronic
1124460770 15:29889628-29889650 CATCTCTGCAGCCTGGCTGCTGG - Intronic
1128074141 15:64815937-64815959 CCCTTCTGCAGCCTGAAAGGAGG + Exonic
1129446240 15:75620518-75620540 GGCTTCTGCACTCTGAATGCTGG - Intronic
1129517417 15:76165167-76165189 CCCTCCTGCAGCCTGAAGCCTGG + Intronic
1129519196 15:76175469-76175491 ACCTGCTGCTGCCTGAATGCTGG + Intronic
1129876360 15:78978153-78978175 CCATTCTCCAGCCTGGATGCTGG + Intronic
1131997329 15:98144900-98144922 CCCTTCTGCGGCCTTAAAGCTGG + Intergenic
1132267052 15:100483475-100483497 CCCTTCTCCAGCCTGAACTCTGG + Intronic
1136410774 16:30075883-30075905 CACTTCTCCAGCCTGAGATCGGG - Intergenic
1138298871 16:55910006-55910028 CACCTCTGCTCCCTGAGTGCTGG + Intronic
1141103524 16:81215068-81215090 CATTTCTGCACCCAGGATGCCGG - Intergenic
1141333834 16:83136770-83136792 ATGTTCCGCAGCCTGAATGCAGG + Intronic
1142335153 16:89484061-89484083 CTCTTCGGCTGCCTGAAAGCTGG + Intronic
1145810709 17:27762357-27762379 CAATCATGCAGCCTGAACGCAGG - Intronic
1146194516 17:30800129-30800151 CTCTTCTGCAGAATGAGTGCTGG - Intronic
1146793844 17:35767786-35767808 CACTGCCGCAGCCTCAATGTTGG + Exonic
1147118823 17:38323025-38323047 CACTTCTGCCATCTGAAGGCTGG - Exonic
1149529872 17:57386638-57386660 CCCTTCTGAAGCCTCCATGCTGG + Intronic
1149529883 17:57386683-57386705 CCCTTCTGAAGCCTCCATGCTGG + Intronic
1151759779 17:76094057-76094079 CACTACTGCAGCCAGGATGCTGG - Intronic
1152301241 17:79496203-79496225 CACTTCTGGATCCTAAAAGCCGG + Intronic
1153145185 18:2023528-2023550 AGCTTCTGCACCATGAATGCTGG + Intergenic
1153691735 18:7601051-7601073 CGCTTCTGCAGCCCCAATGCAGG - Intronic
1155467112 18:26148958-26148980 CACCTCAGCCTCCTGAATGCAGG + Intronic
1158109036 18:53919465-53919487 CACTTCTGGATCCAGAATGGTGG + Intergenic
1158344833 18:56505798-56505820 CACTTCTGCTTCCTAAGTGCAGG - Intergenic
1160210099 18:76870747-76870769 CACTCCTTCAGCCTGAAAGGTGG - Intronic
1160756283 19:758546-758568 GACTTCTGCAGCCTCAGTGCAGG - Exonic
1161041207 19:2111593-2111615 CACTCCTGCAGCCTCCATGCGGG - Intronic
1163641521 19:18465089-18465111 CAAGGCTGCAGCCTGAAAGCAGG + Intronic
1164850785 19:31482462-31482484 CAATTCTGCAGGCTGTATGGAGG + Intergenic
1165127892 19:33613660-33613682 CACTTCTGCAGCCAGGAATCTGG + Intergenic
1165538276 19:36468666-36468688 CCCTTCTGGAGCCTGAGTGGTGG + Intronic
1166327288 19:42059066-42059088 CTGTCCTGCAGCCTGAACGCTGG + Intronic
1166740500 19:45112048-45112070 AACCTCTGCATCCTGAATTCAGG + Intronic
1167842108 19:52130790-52130812 CACTGCTGCAGCCTGTGTGTGGG - Intronic
1167969969 19:53183190-53183212 CACTGCTGCAGCCTGTGTGGGGG - Intronic
1168137003 19:54358868-54358890 CCCTCCTGCAGCCAGATTGCTGG - Intronic
1168161079 19:54510261-54510283 CCCTCCTGCAGCCAGATTGCTGG + Intronic
925075164 2:1010224-1010246 CATTTTTGCAGCCTGAGTTCTGG - Intronic
925657396 2:6164730-6164752 CTCTGCTGTAGCCTGAAGGCTGG - Intergenic
926673392 2:15596723-15596745 TGTTTCTGCAGCCTGAATGAGGG - Exonic
926886083 2:17600092-17600114 CTGTTCTGCAACCTGAATACAGG + Intronic
927815713 2:26215472-26215494 CAGTTTTGCAGCAAGAATGCAGG - Intronic
929043814 2:37771925-37771947 CAGTTCAGCAGCCTGACTGCTGG - Intergenic
931235485 2:60409360-60409382 AACCTCTGCAGCCTGGAAGCCGG + Intergenic
932695027 2:73948787-73948809 AAGTACTGCAGACTGAATGCAGG - Intronic
933042357 2:77485765-77485787 CTCTACTGCAGCCTGAATAATGG - Intronic
933766876 2:85715466-85715488 CACTTCTGAAGACAGAATACAGG + Intergenic
935856365 2:107278991-107279013 CATTACTGCAGCCTCAAAGCTGG + Intergenic
938370922 2:130767956-130767978 GACATCTGGAGCCTGAAAGCAGG - Exonic
938569987 2:132554038-132554060 TACTTCTGCAGCATGAATGAGGG - Intronic
940048171 2:149432471-149432493 CGCTTCAGCAGCCAGAATGGAGG - Intronic
940589405 2:155701944-155701966 CATTTCTGAAGGCTGAATGTAGG + Intergenic
941902779 2:170694058-170694080 CACTGGGGGAGCCTGAATGCAGG + Intergenic
942104430 2:172618857-172618879 CACTTCTCTAGCCTCAATGTGGG - Intergenic
942815369 2:180046836-180046858 AACTTCATCAGCCTCAATGCAGG - Intergenic
942994992 2:182249786-182249808 CAGTTCTGAAGCCTGAGTGAAGG - Intronic
946017751 2:216617610-216617632 CAGTTCTGCAGCCTAAATTGTGG - Intergenic
947080645 2:226392087-226392109 TACTTCTGCATCCTGAAAGATGG + Intergenic
948480113 2:238243820-238243842 CACTCCTGCAGCCTGAAGGAGGG + Intergenic
1168971318 20:1932844-1932866 CACTTCTCCAGCCTGAGCACAGG + Intronic
1169350334 20:4863377-4863399 GACATCTGGAGCCTGACTGCGGG + Intronic
1172014331 20:31863925-31863947 CACTGCTGCCGCCTTAATGGGGG - Exonic
1174159983 20:48543614-48543636 CCCTTCTAAAGCCTGAGTGCTGG - Intergenic
1175551612 20:59821571-59821593 CCCTTCTTATGCCTGAATGCTGG - Intronic
1175795164 20:61766377-61766399 GACTCCTGCAGCCTGGAGGCTGG - Intronic
1181291695 22:21799311-21799333 GACTTCTTCAGCCTGCATCCTGG - Intronic
1181955480 22:26585201-26585223 GGCTTCTGCAGCCAGAAAGCAGG - Intronic
1183194622 22:36344950-36344972 CACATCAGCAGCCTGAGTCCAGG + Intronic
1184924520 22:47627469-47627491 CACTTCTGCAGCATGGTTGCTGG - Intergenic
1203295950 22_KI270736v1_random:43344-43366 CAGTTCAGCAGCCTGACTGCTGG - Intergenic
949607254 3:5666855-5666877 AACTTCTTCAGGCTGAAAGCAGG + Intergenic
950108013 3:10400553-10400575 CACTGCTGCAGCCTTAGTGCCGG + Intronic
952599585 3:35064255-35064277 CACTTCACCAGCCTGAAAGTTGG - Intergenic
952744096 3:36761822-36761844 CAATCCTGCAGCCTGCAGGCGGG - Intergenic
953404202 3:42652579-42652601 CCTTTCTGCAGCTTGACTGCTGG + Intergenic
953498454 3:43409195-43409217 CATTTCTGCTCCATGAATGCTGG - Intronic
961341743 3:126227726-126227748 CACTGCAGCAGGCTGACTGCAGG - Intergenic
961849275 3:129798612-129798634 CACTTCTTTAGGCTGAAAGCAGG - Intronic
963508363 3:146216660-146216682 CGTTTCTGCAGTCAGAATGCTGG - Intronic
963769357 3:149373859-149373881 GACTTATGCAACCAGAATGCAGG - Intronic
967348454 3:188485343-188485365 CACTTCTTCAGCTTAAATGGTGG - Intronic
973581159 4:52345609-52345631 AACTTCTTCAGGCTGAATGGGGG + Intergenic
974730773 4:65862915-65862937 CAGCTCTGCAGCCTGGAAGCAGG + Intergenic
977592798 4:98845020-98845042 AACTTCTTCAGGCTGAATGGGGG + Intergenic
978668444 4:111215212-111215234 GAGTTCTGGAGCCTGACTGCAGG - Intergenic
981246169 4:142541715-142541737 AGCTCCTGCAGCATGAATGCTGG + Intronic
982202655 4:152975042-152975064 CACTTCTGCAGGCTCCAGGCAGG - Exonic
983217641 4:165016977-165016999 CACTTCTGCATCCACAGTGCTGG + Intergenic
985784847 5:1888063-1888085 CGCTTCTGCAGCCTGAGGCCAGG + Intergenic
985908213 5:2858205-2858227 CACTGCTGCAGTCTGTGTGCTGG - Intergenic
987330304 5:16851047-16851069 CACTTTGGGAGCCTGAAAGCGGG - Intronic
988049723 5:26011293-26011315 CAATGCTGTAGTCTGAATGCTGG - Intergenic
988344268 5:30017919-30017941 CATTCCTGGAGCCTGAATGTGGG - Intergenic
988520179 5:31938596-31938618 CTCTTTTGCATACTGAATGCTGG + Intronic
990476722 5:56168716-56168738 CCCATCTGCAGGCTGAATGAAGG + Intronic
991315919 5:65306214-65306236 CATTACTGCTGCATGAATGCTGG - Intronic
992213861 5:74506790-74506812 CACTTCTGCATCCTCTAGGCTGG - Intergenic
992405132 5:76449703-76449725 CACTTCTGCTGCACAAATGCTGG + Intronic
993840776 5:92876148-92876170 CACATGTCCAGCCTGAAAGCTGG - Intergenic
995253525 5:110019755-110019777 CCCTTCTGCTGCCTGCAAGCTGG + Intergenic
997740605 5:136250023-136250045 CAATACTGCAGCCTGAATCCTGG + Intronic
1003184304 6:3817476-3817498 CACTTTGGCCTCCTGAATGCTGG - Intergenic
1003484908 6:6567172-6567194 CACTTATGTAGCATCAATGCTGG + Intergenic
1004725567 6:18308229-18308251 CACTTCTCCTGGCTGAATGCTGG + Intergenic
1006195678 6:32240548-32240570 CACTTCAGCTGCTTGGATGCAGG + Intergenic
1012503101 6:99912436-99912458 CACTTCTTCAGCAAGAATGGAGG - Intergenic
1012901793 6:105014569-105014591 CACCTCAGCTTCCTGAATGCTGG + Intronic
1015795064 6:137003218-137003240 CAACTCTGAAACCTGAATGCAGG + Intronic
1017455499 6:154597589-154597611 CAGTTCTGGGTCCTGAATGCCGG - Intergenic
1018054818 6:160042666-160042688 CACATCTGCAGACTGAGTGCAGG - Intronic
1018547547 6:164954494-164954516 CACTTTTGCAACTTGAAGGCAGG - Intergenic
1018718547 6:166554655-166554677 CTCCACTGCAGCCTGAAAGCAGG + Intronic
1022319186 7:29272255-29272277 CACTTCTGTAGGCTGACTGCAGG - Intronic
1023232429 7:38049581-38049603 CACTACTGGAGCCTGAAAACTGG - Intergenic
1023933649 7:44723433-44723455 AACTTCTTCAGCCTGAATAGGGG + Intergenic
1026425827 7:70292422-70292444 CACTTCTGACTCCTGAATACAGG - Intronic
1028317306 7:89419479-89419501 AACTTCTGGATCCTGAATGTGGG - Intergenic
1031336056 7:120534126-120534148 CACTTCTGCCCCTTGAATGTAGG + Intronic
1031754211 7:125617987-125618009 CACTTCTGGAGCCTGAGGACTGG - Intergenic
1032160343 7:129504665-129504687 CACCTCAGCAGCCTGAGTACTGG + Intronic
1034923338 7:155101458-155101480 CTCTGCTGCAGACTGAATGGTGG - Intergenic
1035738453 8:1907018-1907040 CACTTCTGCACACAGAAGGCAGG - Intronic
1036390546 8:8320716-8320738 CAACACTGCAGCCTGAAGGCAGG - Intronic
1036678847 8:10855774-10855796 CACTCCCGGAGCCTAAATGCAGG - Intergenic
1037659664 8:20915894-20915916 CACATCTGCAGGCTGGCTGCAGG + Intergenic
1038999926 8:32968444-32968466 AACTTCTGCAGTCTGAACACTGG + Intergenic
1040633820 8:49248578-49248600 CACTTCTGCAGCCTGGAGTAGGG - Intergenic
1041369027 8:57140932-57140954 CACTTCTCCAGGTTGAATGAAGG + Intergenic
1042004701 8:64168514-64168536 CCCTGCTGCAGCCTGCATGGTGG - Intergenic
1042395909 8:68292327-68292349 CTCTCCTGCAGCCAGAATGATGG - Intergenic
1044962272 8:97542775-97542797 CATCTCTGCAGCCTGCATCCTGG + Intergenic
1047753552 8:127900764-127900786 CACATTTGCAGCCTGACTGGAGG + Intergenic
1048448688 8:134512337-134512359 TGCTTCTGCAGTCTGAACGCTGG + Intronic
1048514393 8:135092850-135092872 CACACCTGCAGCCTGAAGCCTGG - Intergenic
1057132305 9:92662576-92662598 TACTTCTGCAGTCTGAGGGCTGG + Intronic
1057872992 9:98732163-98732185 GAATTCTGCAGCCAGAATGAAGG - Exonic
1059008358 9:110428953-110428975 CACTTCAGCCTCCTGAGTGCAGG - Intronic
1059045688 9:110863624-110863646 GACTTCTACAGTCTGAAAGCAGG + Intergenic
1060670935 9:125468731-125468753 GACCTCTGCAGCCTGAAGCCAGG - Intronic
1060676481 9:125519860-125519882 CAGTTCTGAAGCCTCCATGCAGG + Intronic
1060944715 9:127563184-127563206 CACTGCTGGGGCCTGAGTGCCGG - Intronic
1061170061 9:128947459-128947481 CACTTCTGCGGCCTGGGAGCTGG + Exonic
1061335247 9:129929484-129929506 CACTTCTGAATCGTGATTGCTGG - Intronic
1062181780 9:135194886-135194908 CCCTCCTGCTGCCTGGATGCTGG + Intergenic
1062264780 9:135681952-135681974 CTCTGCTGCAGCCTGCATGGGGG + Intergenic
1188968593 X:36584641-36584663 CACTTCTGGAGCCTGAATTTCGG - Intergenic
1192204556 X:69087499-69087521 CAATTCTGCAATCTAAATGCTGG + Intergenic
1192474399 X:71427366-71427388 CACTTCTACTGCCAGAATTCTGG - Intronic
1195997378 X:110744777-110744799 CCCTTCTCCAGACTGAATTCTGG + Intronic
1198699630 X:139382812-139382834 CCCTGCTGCAGCCAGAATGATGG + Intergenic
1200757597 Y:7004881-7004903 ACCTGCTGCAGCCTGCATGCCGG + Intronic