ID: 1120757068

View in Genome Browser
Species Human (GRCh38)
Location 14:88254385-88254407
Sequence TGAAGGGAATAGCATTTCAC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 194
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 185}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120757068_1120757073 2 Left 1120757068 14:88254385-88254407 CCCGTGAAATGCTATTCCCTTCA 0: 1
1: 0
2: 0
3: 8
4: 185
Right 1120757073 14:88254410-88254432 GAGGCTATGACCAGAAGAAATGG 0: 1
1: 0
2: 1
3: 24
4: 244
1120757068_1120757074 11 Left 1120757068 14:88254385-88254407 CCCGTGAAATGCTATTCCCTTCA 0: 1
1: 0
2: 0
3: 8
4: 185
Right 1120757074 14:88254419-88254441 ACCAGAAGAAATGGCAGCCATGG 0: 1
1: 0
2: 5
3: 29
4: 359
1120757068_1120757076 12 Left 1120757068 14:88254385-88254407 CCCGTGAAATGCTATTCCCTTCA 0: 1
1: 0
2: 0
3: 8
4: 185
Right 1120757076 14:88254420-88254442 CCAGAAGAAATGGCAGCCATGGG 0: 1
1: 0
2: 3
3: 25
4: 235

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120757068 Original CRISPR TGAAGGGAATAGCATTTCAC GGG (reversed) Intronic
900112143 1:1012407-1012429 AGCAGGAAATAGCATCTCACTGG + Intergenic
902941231 1:19801341-19801363 TGAAGGAAGGAACATTTCACAGG - Intergenic
906806546 1:48784399-48784421 TGAAGGGGACAGCATTTGGCGGG - Intronic
909272214 1:73637741-73637763 GGAAGGGAATAGAATTTCTGAGG - Intergenic
910030272 1:82712318-82712340 TTAAGGGAGTAGTATTTCATAGG - Intergenic
914436490 1:147664816-147664838 TGAAGGCCATAGCAGTTCAAAGG + Intronic
915113319 1:153578713-153578735 TGAATGGAATGACATTCCACTGG - Intergenic
920901933 1:210117936-210117958 TGAAGGGATTAGCATTTGGATGG - Intronic
921582307 1:216909165-216909187 TGACGGTAATAATATTTCACTGG + Intronic
922140768 1:222884139-222884161 TGAAGGGATAAGAATTTCAAGGG - Intronic
922299313 1:224282415-224282437 TACAGAGACTAGCATTTCACTGG - Intronic
922338998 1:224640666-224640688 TGAAGTGAAAAGCCCTTCACCGG + Intronic
924774895 1:247109537-247109559 TAAAGATAATAGCATTTTACTGG + Intergenic
1063517673 10:6712519-6712541 TGAAGGGAAATTCATTTCAGTGG + Intergenic
1063651873 10:7946162-7946184 TGAAGGGTATAGGAAGTCACCGG - Intronic
1066084888 10:31966644-31966666 TGAATGGAAGACCATTTCAAAGG + Intergenic
1066737101 10:38489422-38489444 TGAATGGAATAGAATTTAATGGG + Intergenic
1067840586 10:49674694-49674716 TGATAGGAATAGCATTTAATCGG - Intergenic
1067973930 10:51002635-51002657 TGAATGAAATAGCCTTTTACAGG - Intronic
1069259652 10:66378721-66378743 TGAAGGTAAGAGCATTTCTCTGG + Intronic
1070870552 10:79747885-79747907 TGAAGGGAATGGAAATACACAGG - Intergenic
1070887810 10:79920659-79920681 TGGAGGCAATGGCATTTTACAGG - Intergenic
1071637470 10:87270097-87270119 TGAAGGGAATGGAAATACACAGG - Intergenic
1071657775 10:87467854-87467876 TGAAGGGAATGGAAATACACAGG + Intergenic
1079955519 11:26859157-26859179 TGAAGGCAATAGCACCTCACAGG - Intergenic
1080273798 11:30480298-30480320 TGAAGGGAAAGGCATTTAAAAGG - Intronic
1082271909 11:50181374-50181396 AAAAGGGAAGAGCATTTCTCTGG - Intergenic
1085415040 11:76314100-76314122 TGAAGGGAATGCAATTTGACGGG + Intergenic
1085538751 11:77245949-77245971 TGAGGGAAATAGCATTTGAAGGG - Intronic
1087867400 11:103247830-103247852 TGATGGGTATAGCATTGCATTGG + Intronic
1087890289 11:103530559-103530581 TGATTTGAATAGCATTTTACAGG + Intergenic
1088123712 11:106398480-106398502 TGAGGGTAAGAGCATTTCTCTGG + Intergenic
1088512574 11:110593521-110593543 TGAAGGGAATGGCATAGCACTGG + Intronic
1090938145 11:131363570-131363592 TGAAGGGAATAGCATGGTAAAGG - Intergenic
1093066100 12:14659823-14659845 TCATGGGCATAGCATTGCACTGG + Intronic
1096912887 12:55001718-55001740 TGATGGGATTTACATTTCACAGG - Intergenic
1097227741 12:57488453-57488475 GGAAGGGAAGAGCAGTTTACTGG - Intronic
1100016251 12:90014317-90014339 TAAAGGAAATATTATTTCACAGG + Intergenic
1100222499 12:92520910-92520932 TGAAGGAAAAATCCTTTCACAGG + Intergenic
1102534793 12:113573387-113573409 TGAAGGGTATAGCAGCTCCCTGG + Intergenic
1102624451 12:114223757-114223779 TGAAGGTATTAGAATTTCCCTGG + Intergenic
1106202896 13:27557192-27557214 TAAAGGCATTAGCTTTTCACAGG - Intronic
1111895165 13:94132692-94132714 TGAAAGGCACAGCATTTAACTGG + Intronic
1113309863 13:109121096-109121118 TCAAGGGACTAGCATGTAACAGG - Intronic
1114479891 14:23026334-23026356 TGAAGGGAACCGGATTTCAGGGG - Exonic
1115301614 14:31891997-31892019 TGAGCTGAATAGCATTCCACAGG - Intergenic
1118640472 14:67787700-67787722 TGAGGGGAAGAGCAGATCACTGG + Intronic
1119565830 14:75628580-75628602 AGCAGGCAACAGCATTTCACAGG + Intronic
1119786868 14:77320776-77320798 TGAAGGGCGTTGCATTTCCCGGG - Exonic
1120757068 14:88254385-88254407 TGAAGGGAATAGCATTTCACGGG - Intronic
1125281115 15:38043440-38043462 TGTAGGGAAAAGCCCTTCACTGG + Intergenic
1125309267 15:38360748-38360770 TGAGGGTAATAGGAATTCACTGG + Intergenic
1126790812 15:52219424-52219446 TGCATGGTATAGCATTTCAAGGG + Intronic
1127586799 15:60385838-60385860 TGAAGGAAATATCATGGCACTGG - Intronic
1127877451 15:63122777-63122799 TAAATGCAATAGCATTTCATGGG - Intronic
1127998503 15:64169824-64169846 GCTAGGGAATATCATTTCACTGG - Exonic
1128848107 15:70919630-70919652 TGGTGGGAAAAGCATTGCACAGG + Intronic
1135076092 16:19394956-19394978 TAAAGATAATAGCATTTTACCGG - Intergenic
1138222974 16:55268804-55268826 TGAGGTGAGTAGCATTTCCCTGG + Intergenic
1138331235 16:56217204-56217226 TGAAGGCAAGAACATGTCACAGG - Intronic
1140347288 16:74226460-74226482 GGAAGAGACCAGCATTTCACTGG - Intergenic
1146473172 17:33140569-33140591 TGGAGGAAATAGCTTTTCATGGG - Intronic
1146515283 17:33484380-33484402 TGCAGGGAAATGCATTTCAATGG - Intronic
1156279291 18:35618906-35618928 GGCAGAGAATAGCTTTTCACAGG + Intronic
1157949028 18:52013633-52013655 GGCAGGGAAGATCATTTCACTGG + Intergenic
1158042663 18:53115175-53115197 TGTATGGCATAGCAGTTCACTGG + Intronic
1158338266 18:56436579-56436601 TGAAAAGAATAGCTTTCCACTGG - Intergenic
1158710717 18:59835525-59835547 TCCAGGGAATATCATTTCAGAGG + Intergenic
1159031479 18:63236907-63236929 TGAAGAGTCTAGAATTTCACTGG - Intronic
1160379455 18:78440510-78440532 GGAAGGGAACAGTATTTAACAGG + Intergenic
1165553258 19:36606275-36606297 TGAAATGAATAGCATTCCATTGG + Intronic
1168249034 19:55130601-55130623 TGAATGCAATAGTATTCCACGGG - Intergenic
926416362 2:12653488-12653510 TGAAGGAAAGAGCATTCCACAGG - Intergenic
926971353 2:18470630-18470652 TGACGGGAAGAGCTTTCCACAGG - Intergenic
928790106 2:34939950-34939972 AGAAGAGAAAAGCATTTTACAGG - Intergenic
930403572 2:50924474-50924496 AGAAAAGAAAAGCATTTCACAGG + Intronic
930514339 2:52387208-52387230 TCAAAGGAATTTCATTTCACTGG + Intergenic
931943638 2:67281201-67281223 TGATCAGAATAGCACTTCACAGG - Intergenic
933784867 2:85830541-85830563 TGAGTGGAATAGCATGTCAATGG - Intergenic
936484060 2:112911504-112911526 AGAAGGGACTAGCATTTCCAGGG - Intergenic
938662957 2:133506159-133506181 TGAAGAGAACACCATGTCACTGG + Intronic
941321997 2:164067408-164067430 TAAAGGGAATAATTTTTCACTGG + Intergenic
943214682 2:185015467-185015489 GGTAGGGAATAGCATTTTTCTGG - Intergenic
943782692 2:191842417-191842439 TTAAGAGACTAGAATTTCACAGG - Intronic
944900332 2:204207346-204207368 TGGAGAGAATAGCATTCCATTGG + Intergenic
945297859 2:208188830-208188852 AGAAAGTAAGAGCATTTCACAGG + Intronic
946731080 2:222710155-222710177 TGAAGGCAAAATCATTTTACAGG + Intergenic
946831781 2:223735124-223735146 TGAAGGGAAGTGCATGTAACAGG + Intergenic
1169268318 20:4181143-4181165 GGAAGGGAGATGCATTTCACGGG - Intronic
1169711455 20:8569083-8569105 TGAATGAAAGAGCATTTCAAGGG - Intronic
1170936451 20:20814247-20814269 AGAAGAGAATAGCATTTGAATGG + Intergenic
1174081850 20:47975598-47975620 TGCAGAGAATAGCATTTACCTGG - Intergenic
1177925758 21:27212623-27212645 TGAACGAAATAGCATTTCCTTGG + Intergenic
1178816514 21:35934932-35934954 TGGAGTGGATAGCATTTCCCCGG - Intronic
1181922677 22:26333035-26333057 TGAATGGGAAAGCATTTCACAGG - Intronic
1182735434 22:32529525-32529547 GGGAGGGAAAAGCATTCCACAGG + Intronic
949826783 3:8173968-8173990 AGAAAGGAATTGCATTTCTCAGG - Intergenic
951302682 3:21017645-21017667 TCCAGGGAATATGATTTCACTGG - Intergenic
951552199 3:23885396-23885418 TAATGGTAATATCATTTCACTGG + Intronic
956835646 3:73094335-73094357 AGCAGGGAATGGGATTTCACCGG - Intergenic
956982795 3:74658463-74658485 AGAAGAGATTAGCATTTGACTGG + Intergenic
957701318 3:83717977-83717999 TGAAGGTACTATCATTTCATAGG + Intergenic
959674149 3:109015584-109015606 AGAAGAGAAAAGCATTTCAGAGG - Intronic
960230678 3:115222736-115222758 TGAAGGAAGGAGCAGTTCACAGG - Intergenic
961975872 3:131024705-131024727 TCAAGGGAAAAGCATTTGGCAGG + Exonic
963063735 3:141245965-141245987 TGATGGAAATAGCATTGAACTGG + Intronic
963275760 3:143328578-143328600 TAAAGGGGATGGCATTGCACTGG - Intronic
964647793 3:158977223-158977245 TGAAGGGAATTGCTTTTCTGGGG + Intronic
964964156 3:162469606-162469628 TGAATTGAATAGTCTTTCACAGG + Intergenic
967452659 3:189644342-189644364 AGAAGGGAATAAATTTTCACAGG - Intronic
969033426 4:4231214-4231236 TGAAGATAATGGGATTTCACAGG + Intergenic
969240706 4:5895185-5895207 GGCTGGGAATAGTATTTCACAGG - Intergenic
970269048 4:14323234-14323256 TGCAGGGAACTGCATTTCCCAGG - Intergenic
971544294 4:27865824-27865846 TGAAGGCAATAGCAAATCCCTGG - Intergenic
971772261 4:30911844-30911866 TGAAATGAATAGCATTTTCCTGG + Intronic
972234047 4:37109335-37109357 TGAATGGATGAGCTTTTCACAGG + Intergenic
972873839 4:43333390-43333412 GGAAGGGAATGGCATTGCTCAGG - Intergenic
975840458 4:78468542-78468564 TCAAGAGAAAAGCATTTTACTGG - Intronic
977610534 4:99025527-99025549 TGTAAAGAAAAGCATTTCACAGG + Intronic
977731237 4:100354826-100354848 GGAAGGGAAAAGCATTTAAGTGG - Intergenic
978606304 4:110483575-110483597 AAAAGGGAAGAGCATTTCTCTGG - Intronic
981482331 4:145251845-145251867 TGAGGGAAATAGCATTTTTCTGG + Intergenic
981873923 4:149518341-149518363 GTAAGGGAATACCCTTTCACAGG - Intergenic
982012603 4:151120864-151120886 TCAATGGAATAGAATTTCATTGG - Exonic
983135891 4:164079967-164079989 TCAAGGGAATTGGATTACACTGG - Intronic
984184978 4:176532854-176532876 TGGAGGGAATTACATTTCAGTGG + Intergenic
984592446 4:181631760-181631782 TCAAAGGAATAGGATTACACAGG + Intergenic
984957380 4:185058804-185058826 TGACAGAAATAGCATTTCATGGG - Intergenic
985017434 4:185651168-185651190 TGAAGGGAAAAACATTTGTCAGG + Intronic
986848315 5:11780965-11780987 TGAAGGAAATAGCACTTTATCGG - Intronic
987243625 5:16026486-16026508 GGAAGGGATTAGCATTTGAATGG - Intergenic
992231193 5:74665884-74665906 TCAATGGAAGAGCATTTCTCTGG + Intronic
992783604 5:80149712-80149734 TGGAGGTAATAGCACGTCACTGG + Intronic
992818235 5:80466611-80466633 TGAAGGGAAAAGCAAGTAACAGG - Intronic
992818342 5:80467750-80467772 TGAAGGGAAAAGCAAGTAACAGG + Intronic
993103572 5:83572502-83572524 TGCAGGGAACATCATTCCACTGG - Exonic
995915316 5:117238852-117238874 TGAAGGGAATTACATTTTAGAGG - Intergenic
997287783 5:132694845-132694867 TGATTAGAATTGCATTTCACTGG - Exonic
997646598 5:135486276-135486298 TGAAGGGAAAGAAATTTCACAGG + Intergenic
998807238 5:145930420-145930442 GGCAGGCAATAGCATTTAACTGG + Intergenic
1000122125 5:158207493-158207515 CAAAAGGAATAGAATTTCACAGG + Intergenic
1000163784 5:158627224-158627246 TGCAGGTAATAGCCATTCACTGG + Intergenic
1002157045 5:177290936-177290958 TGCATGGGATAGCATTTCACAGG + Intronic
1002818129 6:697688-697710 TGAATGGAATGGCCATTCACAGG + Intergenic
1002907936 6:1465951-1465973 AGAAGGAAATAAAATTTCACAGG + Intergenic
1008521480 6:52365630-52365652 TGAAGGGAATATCATTACCTGGG - Intronic
1011206956 6:84909901-84909923 TGAAAGAAAGATCATTTCACAGG + Intergenic
1015994208 6:138980986-138981008 AGAAGTGTTTAGCATTTCACAGG + Intronic
1017067269 6:150540619-150540641 TGAAGGGAATTGCATTTAGGAGG - Intergenic
1017961066 6:159221092-159221114 TGAAGGGCACAGCATTCCACAGG + Intronic
1019164725 6:170090673-170090695 TGAATCCAATAGCACTTCACAGG - Intergenic
1020660561 7:10976021-10976043 TGAAGGAGATACCATTTTACAGG + Intronic
1021272973 7:18615035-18615057 AAAAGGAAATAGCATTTCAATGG + Intronic
1021490393 7:21214064-21214086 TGAAAGTAATACCATTTCAGAGG + Intergenic
1023009033 7:35908747-35908769 GCAAGGGAGCAGCATTTCACCGG + Intergenic
1023017086 7:35979296-35979318 GCAAGGGAGCAGCATTTCACCGG + Intergenic
1023678220 7:42653281-42653303 TGAAGGGAATTGCATTTTAGCGG - Intergenic
1023702171 7:42903639-42903661 TGAAATGAATAGAATTTCCCAGG - Intergenic
1025265477 7:57452997-57453019 CCAAGGGATTAGCATTTTACAGG - Intronic
1027885202 7:83895464-83895486 TCAAGGGAAGAGAATTGCACAGG - Intergenic
1029652675 7:101904430-101904452 TCAAGAGAATAGCATTTCCATGG + Intronic
1032565145 7:132934041-132934063 TTAGCTGAATAGCATTTCACTGG + Intronic
1033182208 7:139191455-139191477 TGAAAATAATAGCAATTCACTGG - Exonic
1037031850 8:14117445-14117467 TGCAGAGTATAGCATCTCACTGG + Intronic
1041300015 8:56401883-56401905 TGCAGGGAATAGAATTAGACAGG + Intergenic
1041952216 8:63516345-63516367 TGAAGTCATTAGCATATCACAGG + Intergenic
1042648652 8:71014714-71014736 TGTAGAGAATATCATTTTACTGG - Intergenic
1043333970 8:79150824-79150846 GGAAGGAAAGAGCATTTCAAAGG + Intergenic
1044882008 8:96732852-96732874 TAAAGGGCATAGCCTTTCAATGG - Intronic
1046026187 8:108727004-108727026 TTGGGGGAATAGCATTTCAGGGG + Intronic
1049075632 8:140394131-140394153 TGCAGGGAATCTCTTTTCACTGG - Intronic
1050408275 9:5333221-5333243 AGAAGGAAATACCATTTCTCTGG + Intergenic
1053179920 9:35960117-35960139 AGAGGGGAATAGGATTGCACAGG - Intergenic
1054836437 9:69679469-69679491 TTAATGAAATAGAATTTCACAGG - Intergenic
1055218614 9:73899155-73899177 TTAAGAGAATAGCATTTTAAAGG + Intergenic
1055272414 9:74576177-74576199 TCAAGGTAATTGCATTTTACTGG - Intronic
1057939010 9:99264374-99264396 GGAAGGGAATAACATCTCAGGGG - Intergenic
1060254741 9:122017387-122017409 TGAAGGGAATATCCTCGCACAGG - Intronic
1060448859 9:123718196-123718218 TCAAGGGAATGGGATTTCCCAGG + Intronic
1188595241 X:31892332-31892354 TGATGGGCATAGAACTTCACCGG + Intronic
1193245778 X:79227233-79227255 TGAAGAGAATATCTTTTCCCAGG + Intergenic
1196315456 X:114217035-114217057 TCAAGGGAATAAAATATCACAGG - Intergenic
1197286496 X:124601362-124601384 TGAAGGGACTGACCTTTCACAGG + Intronic
1197912419 X:131497722-131497744 TGATGGGGATAGCACATCACTGG + Intergenic
1198224852 X:134635718-134635740 TGCAGGGAAGTGCATTTCAGAGG - Intronic
1198423181 X:136488300-136488322 TGATGAGAATAGCATTTCCAAGG - Exonic
1198495942 X:137193507-137193529 TATAGGGTCTAGCATTTCACAGG - Intergenic
1198626631 X:138583005-138583027 TCAAGGGAAGAGGATTACACAGG + Intergenic
1198832726 X:140767882-140767904 TCATGGGAATGGCATTTCATGGG - Intergenic
1198870206 X:141171027-141171049 TGAAGGGATTTGTATTTCAATGG - Intergenic
1200235082 X:154464251-154464273 TGAGGGGCAGAGCAGTTCACCGG - Exonic
1200982493 Y:9275080-9275102 TAAAGATAATAGCATTTTACTGG - Intergenic
1202113414 Y:21447933-21447955 TAAAGATAATAGCATTTTACTGG - Intergenic
1202151380 Y:21846847-21846869 TAAAGATAATAGCATTTTACTGG - Intergenic