ID: 1120757981

View in Genome Browser
Species Human (GRCh38)
Location 14:88262170-88262192
Sequence TCTAAAGTTTGGAAGGTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 270
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 248}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120757981 Original CRISPR TCTAAAGTTTGGAAGGTGGA GGG (reversed) Intronic
902889394 1:19430984-19431006 TTTAAAGTTGGACAGGTGGAGGG - Intronic
906482671 1:46209816-46209838 TGTAAATTTTGGAAAGAGGAAGG + Intronic
907359743 1:53904881-53904903 TCTCAAGGTTGGGAGGTGGAAGG + Intronic
907708250 1:56851625-56851647 TCTGAAGTTTTGCAGTTGGACGG + Intergenic
907961572 1:59288329-59288351 TCTAAATCTTGGTAGGAGGAGGG - Intergenic
908938005 1:69398948-69398970 TCTAAAGTTTAGAGGATGAAGGG + Intergenic
909176036 1:72360294-72360316 TATAAAGTTTGGTAGTTTGAGGG - Intergenic
909959708 1:81824763-81824785 TCTGAAGTTTATTAGGTGGAGGG + Intronic
910067789 1:83174350-83174372 CCTTCAGTTGGGAAGGTGGAGGG + Intergenic
910803876 1:91171421-91171443 CCTAAGGTTTTGAAGGTAGAAGG + Intergenic
910889561 1:92003024-92003046 TCTAAAGGTGAGAAGGTGGAAGG + Intronic
911084660 1:93966359-93966381 TTTAAAGTTTGGAAGGATAATGG - Intergenic
915572169 1:156750761-156750783 TCTAAAGTTGGAAAGGTCGAAGG - Intronic
916606698 1:166349993-166350015 ACTAAGGTGTGGAAGGTGAAGGG + Intergenic
917389660 1:174521621-174521643 AATAAAATTTGGAAGCTGGAAGG + Intronic
917740286 1:177955244-177955266 CCTACACTTTGGGAGGTGGAGGG + Intronic
919188321 1:194183496-194183518 TCTACAGGTTGGCAGGAGGAGGG - Intergenic
920098048 1:203499396-203499418 TCTAAAGGATGCAAGATGGACGG + Intronic
921816843 1:219574039-219574061 ACTAAAGTCTGGAAGGAGAATGG + Intergenic
922907363 1:229184486-229184508 TCTACAGGGTGGAGGGTGGAAGG + Intergenic
922974673 1:229774349-229774371 ACGAAAGTTGGGAGGGTGGAAGG + Intergenic
922996405 1:229965789-229965811 ACAAAATTTTGGAAGCTGGAAGG - Intergenic
1063135272 10:3210812-3210834 TATAATGTTGGGAATGTGGAAGG - Intergenic
1064418590 10:15170814-15170836 TCTAAAGTTTATTTGGTGGATGG + Intergenic
1064784949 10:18884113-18884135 TCCAAATTTTGGCAGGTGCAGGG + Intergenic
1064844115 10:19632307-19632329 ACTGGAGATTGGAAGGTGGAAGG - Intronic
1066070151 10:31800171-31800193 TCTAAAGTATGGAAGATGGCAGG - Intergenic
1067523031 10:47022330-47022352 TTTAGAGCTTCGAAGGTGGAGGG + Intergenic
1068498344 10:57813955-57813977 ACTAGAGTGGGGAAGGTGGAAGG - Intergenic
1071227542 10:83548029-83548051 TCTAAAGGAGGGAAGGTAGAGGG + Intergenic
1075582663 10:123634019-123634041 CCTAGAGTTTGGAAGGGGGTGGG + Intergenic
1075639744 10:124056219-124056241 TCAAAAGATTGGAAGGGGGAAGG - Intronic
1076222838 10:128748431-128748453 CCTTAAGCTTGGGAGGTGGAAGG - Intergenic
1077789299 11:5421240-5421262 TCTCTAGTCTGGAGGGTGGAAGG - Intronic
1079147172 11:17863430-17863452 TCTAAAGTGTGAATGGTTGAGGG - Intronic
1079870169 11:25787898-25787920 TTTAAAGTTTTGAAGGAAGAAGG - Intergenic
1080103590 11:28487850-28487872 TCTATAGTTTGGAAGTAAGAAGG + Intergenic
1081124348 11:39304485-39304507 TGTAAAGTTTGGAATTTGGAGGG - Intergenic
1082846730 11:57732199-57732221 GCAAAACTTTAGAAGGTGGAGGG + Intronic
1085225267 11:74914280-74914302 TCTAAAATTTAAAAGGGGGATGG - Intronic
1087547307 11:99601088-99601110 TCCAAAGTTTGGCACTTGGAAGG + Intronic
1088015047 11:105048354-105048376 TCTAAAGCTTGGAAATGGGATGG - Intronic
1090111070 11:123910202-123910224 TTTAAAATTTTGAAGGTTGAAGG + Intergenic
1090432067 11:126654436-126654458 TCTGAAATGTTGAAGGTGGAGGG + Intronic
1091514166 12:1161295-1161317 TTGAAAGTTTGCAAGGTAGATGG + Intronic
1093183258 12:15990597-15990619 TTTGGAGTTTGGAGGGTGGAAGG - Intronic
1093849596 12:24019435-24019457 TATAAAGTTTTAAAGATGGAAGG + Intergenic
1095459951 12:42433167-42433189 GCTAAAGTTTGGATGATGAAAGG - Intronic
1096081733 12:48837827-48837849 TCTGGAGTTTGGAAAGGGGAAGG - Intronic
1096249937 12:50024500-50024522 ACAAAAGATGGGAAGGTGGAGGG + Intronic
1102614856 12:114144738-114144760 GCTAAAGTGTGGAAGCTGGGTGG - Intergenic
1104058960 12:125251951-125251973 TCTAGAATTTGGGAGCTGGAAGG + Intronic
1104064762 12:125297456-125297478 TCTAAAACTTGGAGGATGGATGG - Intronic
1105816866 13:24044079-24044101 GCTAAAGCCCGGAAGGTGGAGGG + Intronic
1106601375 13:31190045-31190067 TCTGAAGTTTGGAATCTGAATGG - Intergenic
1107420974 13:40246126-40246148 CCTGAAGTTGGGAAGATGGAGGG + Intergenic
1107425229 13:40286345-40286367 TCTAAACTTTAAAAGGAGGATGG + Intergenic
1108470209 13:50759902-50759924 TCCAAAGGATGGAAGGTGGCTGG - Intronic
1111037928 13:82704211-82704233 CCTGAAGGTTGGAAGGGGGATGG - Intergenic
1111608450 13:90571792-90571814 GCTCAAGTTTGGAAGCTGAAAGG + Intergenic
1111851802 13:93584984-93585006 TTTAAAGTTTATAAGGTGGCCGG - Intronic
1112914349 13:104528188-104528210 TCTAATGTTTTGAAAGTGGTGGG - Intergenic
1115495900 14:34004291-34004313 TATAAAATTTGGGAAGTGGAGGG + Intronic
1115698258 14:35923721-35923743 TTTAAAGTTTGTATGGTGGCCGG + Intronic
1115795197 14:36927448-36927470 TCTTAAGATTTGAAGGTGAAGGG + Intronic
1116411078 14:44624621-44624643 TGAAAAGTTTGCAGGGTGGATGG - Intergenic
1117998939 14:61505236-61505258 TCTAAAGGCTGGAAAGTGCAAGG + Intronic
1118169673 14:63375807-63375829 TCCAAAGTTTGGACAGTAGATGG - Exonic
1120757981 14:88262170-88262192 TCTAAAGTTTGGAAGGTGGAGGG - Intronic
1123787917 15:23690874-23690896 TCCAAAGTTGGGAGGGTGTAGGG + Intergenic
1123907029 15:24931582-24931604 CCTACACTTTGGGAGGTGGAGGG + Intronic
1124841702 15:33248122-33248144 TCTGACGTTTCAAAGGTGGAAGG + Intergenic
1130154881 15:81341673-81341695 TCTTATCTTTAGAAGGTGGAGGG - Intronic
1130885225 15:88087249-88087271 GCTAAAGAGTGGAAGGTGGAGGG + Intronic
1135949480 16:26900414-26900436 TCATCAGTTTGGGAGGTGGACGG + Intergenic
1136663299 16:31784242-31784264 ACGAAAGGTTGGAGGGTGGAAGG - Intronic
1137722875 16:50638118-50638140 TCTGAAGTGTGGCAGGAGGAGGG + Exonic
1138573241 16:57889470-57889492 TCTCAAGTCTGGATGGGGGAAGG - Intronic
1139197818 16:64941412-64941434 TCAAAACATTGGGAGGTGGAGGG + Intergenic
1139294358 16:65887352-65887374 TATACATTTTGGAGGGTGGAGGG - Intergenic
1139557345 16:67720695-67720717 ACTTAAGTTTGGAAAGTGCAGGG + Intergenic
1140656645 16:77147992-77148014 TCTACTGTCTGGAATGTGGATGG - Intergenic
1143530721 17:7501764-7501786 TGTGAAGTTTGGGAGGAGGAAGG + Intronic
1144513356 17:15896741-15896763 TCTAAAGTTTGGCAGCTAAAAGG - Intergenic
1147014151 17:37477008-37477030 TCAGAAGTTTGGAATGTGGTGGG + Exonic
1148019842 17:44546460-44546482 TTTGAGATTTGGAAGGTGGAAGG - Intergenic
1148413419 17:47487415-47487437 TTTAAAGTTGGGATGGTGGCTGG - Intergenic
1149298610 17:55284174-55284196 TTTAAAGTTAGGAGGCTGGAAGG - Intronic
1149648707 17:58261944-58261966 TCAAAAGTGGGGAAGGTGAAGGG - Intronic
1152300038 17:79490327-79490349 TTTAAAGCTTGCAAAGTGGAGGG + Intronic
1153939158 18:9962313-9962335 TCAAAAGTCTGAAAGGTGGCCGG - Intergenic
1154046068 18:10905994-10906016 TCTAAAACTTGGGAGGTGGTTGG + Intronic
1156594818 18:38536336-38536358 TCTCATGTTTGGTCGGTGGAAGG - Intergenic
1156950807 18:42895410-42895432 TCTTAAGATTGTAATGTGGAAGG - Intronic
1157240789 18:46007848-46007870 TGTCAAGTTAGGGAGGTGGATGG - Intronic
1157268940 18:46254903-46254925 TCTAAATTTTGGGGGGTGGGTGG - Intronic
1158110973 18:53941211-53941233 GGTAAAGTCTGGAAGGTGTATGG - Intergenic
1158477803 18:57795757-57795779 TAAAAAGTTCTGAAGGTGGATGG + Intronic
1165004160 19:32790659-32790681 TCTCAAGTCTGGAGGGAGGAAGG - Exonic
1167224515 19:48228698-48228720 TCTAGATTTTGGCGGGTGGAAGG + Intronic
926546146 2:14242737-14242759 CCTGAAGTTTGGAAGGCAGAGGG + Intergenic
928429885 2:31208532-31208554 TCTAAACTTTGGAGGGTGAGAGG - Intronic
929832434 2:45357944-45357966 TGTAAGGTTTGGGAGGTAGAAGG + Intergenic
935439000 2:103069422-103069444 TGGAAGGTCTGGAAGGTGGAAGG - Intergenic
936496139 2:113023114-113023136 TCTAAATGTTTGAACGTGGATGG + Intronic
936573949 2:113638010-113638032 TCTCAAGGTTTCAAGGTGGAGGG - Intronic
936648563 2:114400299-114400321 GCTAAAGTGTGGCAGGTAGAAGG - Intergenic
937433025 2:121856304-121856326 TCCAAATTTTGGAAACTGGAAGG - Intergenic
937805284 2:126134806-126134828 TCAAAAATTTGGTATGTGGAAGG + Intergenic
938105141 2:128525136-128525158 TCTGAAGTTTGAAATGTGGCTGG + Intergenic
938123545 2:128653334-128653356 TATAAACTTTGGAAGGTAAAAGG - Intergenic
938593524 2:132763364-132763386 TCTAGAGATTGGAAGGCGCATGG - Intronic
939355347 2:141094450-141094472 TCAAAAATTTGGAAGCCGGATGG - Intronic
940030552 2:149257492-149257514 TCTCAAGTTTGGTAAGGGGAGGG - Intergenic
940797323 2:158094198-158094220 TCTAAAGTAAGGAAGGTGACAGG + Intronic
941510144 2:166397301-166397323 TCCAAAGTGAGGAAGGTGGGAGG - Intergenic
941510858 2:166407612-166407634 GAAAAAGTTTGGAAGGTTGAAGG - Intronic
942339458 2:174928164-174928186 TATAAAGTAAGGAAGGAGGAAGG + Intronic
944105365 2:196073830-196073852 GGTAAAGAGTGGAAGGTGGATGG - Intergenic
947443410 2:230142938-230142960 TGTAAGATTTGGAAGATGGAAGG - Intergenic
1168820411 20:769085-769107 TCTGACATTTTGAAGGTGGAAGG + Intergenic
1168875210 20:1166668-1166690 TCTAAAGGTTTCAAGGTGGTTGG - Exonic
1170060458 20:12253522-12253544 ACGAAATTTTGGAAGGAGGAGGG + Intergenic
1170997420 20:21376640-21376662 TCCAAAGTCCGGAAGGTGGGAGG + Intronic
1172502382 20:35436634-35436656 TCTAAAGTTTTCATGTTGGAAGG + Intronic
1173751157 20:45478003-45478025 TCTCAAGCTTGGTAGGGGGAGGG - Intronic
1174468968 20:50741402-50741424 GGTAAAGGTGGGAAGGTGGAGGG - Intronic
1175351931 20:58328756-58328778 TCTTGAGTATGGAAGGTGGAAGG - Intronic
1175486227 20:59348583-59348605 TTTAAAGTTTGGATGGTGAGAGG + Intergenic
1175502492 20:59460393-59460415 TCTACAGTTTGCATGGGGGAGGG + Intergenic
1177323696 21:19556176-19556198 TCAAATGCTTGGAGGGTGGAGGG - Intergenic
1177869674 21:26556380-26556402 TCTTAGGTCTGGAATGTGGAAGG + Intronic
1178004091 21:28196883-28196905 TCTAGATTTTGGAAGATGTATGG - Intergenic
1179223440 21:39430315-39430337 TCTAAAGTGAGGAAGAAGGAGGG - Intronic
1180030183 21:45201566-45201588 TTTCCATTTTGGAAGGTGGAAGG + Intronic
1181139797 22:20796130-20796152 CCTAAAGGTAGGAAGGAGGATGG - Exonic
1182018768 22:27063329-27063351 TCTAGAGTTTTGAACATGGAAGG - Intergenic
1182657784 22:31903676-31903698 GCTTAGGTGTGGAAGGTGGAGGG - Intronic
1184357726 22:43993763-43993785 TCTAAAATTTGGTAGCTGGCAGG + Intronic
1185426227 22:50772883-50772905 TCTCAAGGTTTCAAGGTGGAGGG + Intronic
949571987 3:5302306-5302328 TATAAGGTAGGGAAGGTGGAGGG - Intergenic
950856224 3:16107927-16107949 TCTAAAGTTTGGGAGAGAGATGG - Intergenic
951844125 3:27067163-27067185 TCTTAAGTTTGGGAGAGGGATGG - Intergenic
952338168 3:32422771-32422793 TATAATGTTTGGTAGGTTGAGGG - Intronic
953434639 3:42868732-42868754 TCTGAAGTTTGGGTGGAGGAAGG - Intronic
954095051 3:48319681-48319703 TGTATAGCTTGGGAGGTGGATGG + Intronic
956175137 3:66465786-66465808 TCTAAAGTTCTGGAGATGGACGG - Intronic
956363439 3:68473204-68473226 AGTGAAGTTTGGAAGGTGGAAGG - Intronic
956762895 3:72459356-72459378 ACAAATGTTTGGAAGGAGGAAGG + Intergenic
957702197 3:83728339-83728361 TCCATAGTTTGGCAAGTGGAAGG - Intergenic
958937351 3:100271305-100271327 CCAAAAGTTTGGTAGCTGGATGG + Intronic
960876619 3:122302090-122302112 ACTAAAGGGTGGAGGGTGGAAGG - Intergenic
962364306 3:134767431-134767453 GCTAAAGTGTGGAGCGTGGAAGG - Intronic
962859597 3:139387428-139387450 TCCAGCTTTTGGAAGGTGGAGGG - Intronic
963627791 3:147694852-147694874 TCTATAGGTTAGAAGGTGGGAGG - Intergenic
964805880 3:160609283-160609305 TCTAAAGTTTGGAAAATACAAGG + Intergenic
965084934 3:164083417-164083439 TCTATAGTTTGGAAGACAGAAGG - Intergenic
965165412 3:165189776-165189798 TATAAAGCTTGGGAGGTGGAGGG + Exonic
966132649 3:176660437-176660459 TATAAAGTTTGGTTTGTGGAAGG + Intergenic
970659183 4:18264966-18264988 TCTAAGGTCTGGAGGGTGGTGGG + Intergenic
971800411 4:31282891-31282913 TCAAAAGATGGGAAGGTAGAAGG + Intergenic
972082447 4:35170937-35170959 TTGGAAGGTTGGAAGGTGGAAGG - Intergenic
973191682 4:47392646-47392668 GCTGAAGATTAGAAGGTGGAAGG - Intronic
974660336 4:64880412-64880434 TCAAAAGTTTAGAAAGAGGAAGG + Intergenic
975279046 4:72539455-72539477 CCTAAAGGTTGGGAGGTGGGTGG - Intronic
976052570 4:81026600-81026622 TCTAAGACTTGGAACGTGGATGG + Intergenic
977209255 4:94199346-94199368 TCTTAATTTGGGAAGGTAGAGGG - Intergenic
977591019 4:98827382-98827404 TGAAAAGATTGGAGGGTGGATGG - Intergenic
978565199 4:110073899-110073921 CCTAAAGTTTGGAAGGGCCATGG - Intronic
978764691 4:112392238-112392260 GATAAAGTTTGGTTGGTGGAGGG - Intronic
979318199 4:119291942-119291964 TTTAAAGTTTGGAATGTTGGTGG + Intronic
979757431 4:124359452-124359474 TATAAATTTTGGAAGGTAGAAGG + Intergenic
980335027 4:131461029-131461051 TATAAAATTTGGAGAGTGGAGGG + Intergenic
980478545 4:133354291-133354313 TATATATTTTGGGAGGTGGATGG + Intergenic
981085487 4:140678905-140678927 TCTAAAGTCTGGAAGATACAAGG + Intronic
981855121 4:149280091-149280113 TCTAAAGTTAGGAGGGGGAAGGG + Intergenic
982319658 4:154064814-154064836 TTTAAAGGTTTGCAGGTGGAAGG + Intergenic
983072809 4:163290095-163290117 TCTAAAGTTTGGATAATGAATGG + Intergenic
983179455 4:164630739-164630761 GCTCAAGGTTGGTAGGTGGAGGG + Intergenic
983313567 4:166097413-166097435 TCTACCATTTGGAAGATGGAGGG + Intronic
983795302 4:171854643-171854665 TCTAGAGGCTGGGAGGTGGAAGG + Intronic
984078820 4:175216475-175216497 TCTAGAGGTTGAAAGGAGGAAGG + Intergenic
985124888 4:186683339-186683361 TCCACAGTTTGCAAGGTGGATGG - Intronic
985124898 4:186683389-186683411 TCCACAGTTTGCAAGGTAGACGG - Intronic
985903612 5:2815700-2815722 TCTTGAGTCTGCAAGGTGGATGG + Intergenic
987483895 5:18497663-18497685 TTAAAAGTTTGGAAGGTGAAAGG + Intergenic
988582212 5:32478141-32478163 TGAAAAGTTTTGAAGATGGATGG + Intergenic
991563067 5:67974898-67974920 TCTAAAGTTTATAAAGTGCAAGG - Intergenic
992673543 5:79083079-79083101 TGTAAATTGTGGGAGGTGGAGGG + Intronic
993181510 5:84559863-84559885 TGAAAAGTTTGGAAGGTCAAGGG - Intergenic
993506007 5:88709134-88709156 TCTAACTTTTGGCAGGGGGATGG - Intergenic
997191375 5:131939420-131939442 ATGAAAGTTTGGAATGTGGAAGG - Intronic
999594338 5:153185443-153185465 TTCAAACTTTAGAAGGTGGAAGG - Intergenic
1000355629 5:160391725-160391747 TCTAAAGTTAGGAAGGAGGTAGG - Intergenic
1000442275 5:161278015-161278037 TATAAAGTCTGGGAGATGGAAGG - Intergenic
1000561172 5:162791249-162791271 TTAAAAGTTTGGAAGATGGATGG + Intergenic
1000955804 5:167542178-167542200 TCTGGCTTTTGGAAGGTGGAGGG - Intronic
1000984828 5:167855636-167855658 TCAAAAATATGGAAGGAGGAAGG + Intronic
1001136729 5:169108681-169108703 TCTGAAGTATGGCATGTGGAGGG - Intronic
1002148975 5:177210881-177210903 TCTAAAAGTGGGAAAGTGGATGG + Exonic
1003929725 6:10912258-10912280 TCTAATGGTTGGAAGATAGATGG + Intronic
1004034325 6:11908056-11908078 AAAAAAGTTTGGAAGGTGGGAGG + Intergenic
1005989892 6:30896233-30896255 ACAAGGGTTTGGAAGGTGGAGGG + Intronic
1006574015 6:35030434-35030456 TCTAAAATTTGGAATTTGGAAGG + Intronic
1009907209 6:69884736-69884758 TCTAATTTTTGGAAGGAGAAGGG + Intronic
1010211268 6:73364178-73364200 TCTGTATTTTGGAAGGTAGAGGG + Intergenic
1011762203 6:90579394-90579416 TCTAAGGTTTGGACAGAGGAAGG - Intronic
1011873622 6:91927697-91927719 TCTAAAGTTTGCCAGTTGCAAGG + Intergenic
1013280559 6:108632588-108632610 TCTAAATATGGGAAGGAGGAGGG - Intronic
1014559037 6:122868609-122868631 TCAAAATGGTGGAAGGTGGAAGG - Intergenic
1017530053 6:155280782-155280804 TCTTGAGTTTGGTGGGTGGATGG - Intronic
1018060433 6:160085837-160085859 TCTGCAGGTTGGTAGGTGGAGGG + Intronic
1018815138 6:167324949-167324971 TCTGAAGCTTGGAGGGAGGAAGG + Intergenic
1019655183 7:2189693-2189715 GATAAAGTTTTGGAGGTGGATGG + Intronic
1020075639 7:5256649-5256671 TTCAAAGTCTGGAATGTGGAGGG + Intergenic
1020856814 7:13437329-13437351 TCTAAAGATTCTAAGGTAGAAGG - Intergenic
1021514015 7:21463243-21463265 TCTACAGATTGTAAGGTGCAAGG + Intronic
1021864321 7:24939825-24939847 ACTAAAGTTAGGAGGGTGGGAGG + Intronic
1025203435 7:56976898-56976920 TTCAAAGTCTGGAATGTGGAGGG - Intergenic
1025668509 7:63600029-63600051 TTCAAAGTCTGGAATGTGGAGGG + Intergenic
1027276308 7:76560411-76560433 CCTTCAGTTGGGAAGGTGGAGGG - Intergenic
1028918598 7:96286929-96286951 TCTTTAGCTTGGGAGGTGGAAGG - Intronic
1032312577 7:130802368-130802390 GCTAGAGTTTGGTAGGGGGAGGG - Intergenic
1033768441 7:144521572-144521594 TATAAAGTTTGGAAGGACGACGG - Intronic
1034783777 7:153906346-153906368 TCCAAAGATTGGAGGGTGGGAGG - Intronic
1035984422 8:4410858-4410880 TAATAAGTTTGGAAGGAGGAGGG + Intronic
1036694532 8:10965921-10965943 CCTAGAGTTTGGGAGGTTGAAGG - Intronic
1037139911 8:15507161-15507183 TCTATAGTTTGGACTATGGAGGG - Intronic
1037166085 8:15830752-15830774 TCCAAAGGGAGGAAGGTGGAAGG + Intergenic
1037629317 8:20638841-20638863 TCAAAAGGTGGGAGGGTGGAAGG - Intergenic
1039154093 8:34535803-34535825 TCTGAAGTTTGGTGGGGGGAGGG + Intergenic
1039286939 8:36052024-36052046 TGGAAAGTTTGGAAGGTGGAAGG + Intergenic
1039766001 8:40628667-40628689 TGTAAAGGTTGGTAGCTGGATGG + Intronic
1041793974 8:61726815-61726837 TGGAAACTTGGGAAGGTGGAAGG - Intergenic
1042096456 8:65221290-65221312 TATAACCTTTGGAATGTGGAGGG + Intergenic
1042768661 8:72354910-72354932 AGTAAAGTTTGGAAAGTGTAAGG - Intergenic
1044223316 8:89695660-89695682 TTGAAGGTTTGGAAGGTGCAAGG - Intergenic
1045423016 8:102035352-102035374 TTTAAACTTTGGAAGAGGGAGGG - Intronic
1045761065 8:105608173-105608195 ACTTGAGTTTGGAGGGTGGAAGG + Intronic
1045840915 8:106579617-106579639 TCTTAAGTCTGGATGGTGAAAGG - Intronic
1046577215 8:116045492-116045514 ACTAGAGTTGGGAGGGTGGAAGG - Intergenic
1046764070 8:118050866-118050888 TCTAAGAATTAGAAGGTGGAGGG + Intronic
1047274824 8:123397794-123397816 TATAAAGTAGGGAAGGGGGAGGG + Intronic
1047670647 8:127142680-127142702 GCTACAGTTTGGGAGATGGAAGG - Intergenic
1047746793 8:127851157-127851179 TATAAACTTTGGCAGGTGGGTGG + Intergenic
1048237565 8:132706536-132706558 TATAGAGTTTGGAAGTTGGAGGG + Intronic
1050803774 9:9648281-9648303 CCTAACCTTTGGAAGGTGCAGGG + Intronic
1051146988 9:14037275-14037297 TCTAAAGTTGGAAAGGAGTAGGG - Intergenic
1051925002 9:22314661-22314683 GCTATGGTTTGGAAGTTGGAGGG - Intergenic
1052874564 9:33545545-33545567 TCTAAAGCTTAGAAGGTGTTTGG + Intronic
1053501457 9:38598748-38598770 TCTAAAGCTTAGAAGGTGTTTGG - Intergenic
1053526665 9:38837162-38837184 TCTCACGTTTGGAGGCTGGAGGG + Intergenic
1055192209 9:73539130-73539152 TATGAAATATGGAAGGTGGAGGG + Intergenic
1057020408 9:91692965-91692987 TCTAAAGGCTGGAAGTTTGAAGG - Intronic
1057680851 9:97183131-97183153 TCTAAAGCTTAGAAGGTGTTTGG - Intergenic
1058114174 9:101066377-101066399 TCCAAAGTATGGAAGGGGGTAGG - Intronic
1061522144 9:131125132-131125154 CTTAAAGTGTGGAAGGTGGAAGG - Intergenic
1187047001 X:15656609-15656631 TCTCCAGTGTGGCAGGTGGATGG - Intronic
1188800232 X:34520922-34520944 TCTAAATTTCAGAAGATGGAAGG + Intergenic
1190436330 X:50429342-50429364 AATAAAGTTTGGCAGGGGGATGG - Intronic
1191154030 X:57252148-57252170 GCTGAAGTTTGGCAGGGGGAGGG + Intergenic
1192047750 X:67694540-67694562 TGTAAAGTTGGGGAGGTGGGCGG - Intronic
1193205661 X:78744940-78744962 TCTAACATTTGTAAGGTGGAAGG - Intergenic
1193359157 X:80560625-80560647 TCTTAAGGATGGAGGGTGGATGG - Intergenic
1193477248 X:81981859-81981881 GCTGAAGTTTGGCAGGCGGAGGG + Intergenic
1193973364 X:88085892-88085914 ACTTGAGTGTGGAAGGTGGAAGG - Intergenic
1197291283 X:124661588-124661610 TCTTAACTTTGGATGGTGGCAGG + Intronic
1197778092 X:130133407-130133429 TATAAAGTTGGGAAGGAGGCGGG - Exonic
1199056310 X:143299180-143299202 TCTTTTCTTTGGAAGGTGGAAGG - Intergenic
1199157916 X:144572066-144572088 TCTAGATTTTGGAAGATGTATGG + Intergenic