ID: 1120759662

View in Genome Browser
Species Human (GRCh38)
Location 14:88274133-88274155
Sequence GGCCAGGGAAAGAACCATGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 308
Summary {0: 1, 1: 0, 2: 0, 3: 29, 4: 278}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120759662_1120759667 -1 Left 1120759662 14:88274133-88274155 CCGCCATGGTTCTTTCCCTGGCC 0: 1
1: 0
2: 0
3: 29
4: 278
Right 1120759667 14:88274155-88274177 CTCCAATGTCCCGTGTGCTCAGG 0: 1
1: 0
2: 1
3: 11
4: 88
1120759662_1120759668 0 Left 1120759662 14:88274133-88274155 CCGCCATGGTTCTTTCCCTGGCC 0: 1
1: 0
2: 0
3: 29
4: 278
Right 1120759668 14:88274156-88274178 TCCAATGTCCCGTGTGCTCAGGG 0: 1
1: 0
2: 1
3: 9
4: 86

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120759662 Original CRISPR GGCCAGGGAAAGAACCATGG CGG (reversed) Intronic
902800137 1:18824366-18824388 GGCCAAGGACAGAAGCATGGGGG + Intergenic
903445316 1:23419003-23419025 GGGGAGGGAAAGACCCCTGGTGG - Intronic
903701395 1:25251068-25251090 GGGCAGGGAAAGAACTCTAGGGG + Intronic
904026295 1:27505644-27505666 GGCCAGGGAAAGCATGAGGGAGG - Intergenic
904308225 1:29604568-29604590 GGCCAGGGAAAGAAGCACTCAGG + Intergenic
910105947 1:83631280-83631302 AGCCAGGGATAGGACAATGGGGG - Intergenic
911177206 1:94828724-94828746 GGCCAGCGATAAAAACATGGAGG + Intronic
912714304 1:111971545-111971567 GGCCAGGGAAAGATGAAGGGAGG - Intronic
912951535 1:114123861-114123883 TGCCAGGGAAAGAGCCGGGGAGG - Intronic
913035081 1:114956677-114956699 AGCCTGGGAAAGATCCAAGGAGG - Intronic
913286674 1:117233029-117233051 GCCCAGGGAAGGCAACATGGAGG - Intergenic
913599585 1:120410377-120410399 GGCCATGGGAAGAACCCTGGAGG - Intergenic
914087796 1:144469238-144469260 GGCCATGGGAAGAACCCTGGAGG + Intergenic
914310817 1:146464966-146464988 GGCCATGGGAAGAACCCTTGAGG - Intergenic
914314358 1:146495756-146495778 GGCCATGGGAAGAACCCTGGAGG + Intergenic
914499991 1:148237625-148237647 GGCCATGGGAAGAACCCTGGAGG - Intergenic
914591288 1:149108180-149108202 GGCCATGGGAAGAACCCTGGAGG + Intergenic
919297868 1:195723545-195723567 GGCCAAGAAAAGAAACATGTGGG - Intergenic
919521960 1:198600037-198600059 GGCCATGAAAGCAACCATGGGGG + Intergenic
923710244 1:236382848-236382870 GGCTGGGGAAAGAACCATGTGGG - Intronic
1067084527 10:43230751-43230773 GGCCTGGGCAAGAGCCGTGGGGG - Intronic
1068615122 10:59105886-59105908 GGGCAGAGAAATAAACATGGTGG - Intergenic
1068746988 10:60543835-60543857 GACTAGGGAAAGCACCATGCTGG - Intronic
1069315651 10:67097474-67097496 GGCCACAGATATAACCATGGAGG + Intronic
1069377853 10:67812257-67812279 GGCTAGGGAAAGAACGATGAGGG + Intronic
1069818418 10:71212935-71212957 GGCCAGGGAGACAGCCCTGGGGG + Exonic
1071458345 10:85868464-85868486 GGCCTTGGAAGGAACCATGCGGG + Intronic
1071841706 10:89478247-89478269 TGACAGTGAAAGAACCAAGGAGG + Intronic
1072756219 10:98022910-98022932 GGCCTGGAAAAGAACTTTGGAGG - Intronic
1072756652 10:98025934-98025956 GGGCAGGGAAAGAGGCAAGGAGG + Intronic
1072911592 10:99506685-99506707 GGTCAGGGAATGATTCATGGAGG - Intergenic
1073048992 10:100656033-100656055 GGCCAGGGAGAGAAGGATGGAGG - Intergenic
1073696901 10:105879723-105879745 GGAAAGGGAAATAACCATGTAGG - Intergenic
1074051217 10:109882792-109882814 GGGCAGGGAATGCACCTTGGAGG - Intronic
1075410135 10:122221605-122221627 GTCCAGGGAAAGAGACAGGGAGG - Intronic
1075975147 10:126688008-126688030 GGTCAGGGAGTGAACCATGCTGG - Intergenic
1076223837 10:128757609-128757631 GGCCAGGGTAATAACCAGCGAGG + Intergenic
1076673849 10:132137597-132137619 GGCCAGGGAGAAAGGCATGGTGG - Intronic
1078448756 11:11424756-11424778 TGCTAGGGGCAGAACCATGGAGG + Intronic
1079127814 11:17731245-17731267 GGCCTGGGAGAGCAGCATGGAGG + Intergenic
1082126122 11:48432961-48432983 GGCCAGGAAAAGGTACATGGGGG + Intergenic
1082559711 11:54603813-54603835 GGCCAGGGAAAGGTACATGGGGG + Exonic
1083235654 11:61349249-61349271 GGCCAGGCAAGCAGCCATGGTGG + Exonic
1084094582 11:66902662-66902684 GGCCAGGGCAAGAGTGATGGTGG - Intronic
1084875859 11:72132728-72132750 GGCCAGAGAAAGGACATTGGGGG + Intronic
1085290981 11:75399383-75399405 GTCCAGGGAAAGAAGAATGTAGG - Intergenic
1086699961 11:89889951-89889973 GGTAAGGGAAAGAACCAGAGAGG - Intergenic
1086706209 11:89954565-89954587 GGTAAGGGAAAGAACCAGAGAGG + Intergenic
1087705288 11:101483552-101483574 TGCCAGGTATAGAACCTTGGTGG + Intronic
1088826160 11:113496178-113496200 GGCCTGGGAAAGAAGCACTGGGG - Intergenic
1089100547 11:115958880-115958902 GGCCAGGGGAAGGGCCAAGGCGG - Intergenic
1089530381 11:119124373-119124395 GGCCAGAGAGAGCAACATGGTGG + Intronic
1090355819 11:126139766-126139788 GGGCTGGGAAGGAGCCATGGAGG - Intergenic
1091092100 11:132781099-132781121 GGACTGGGAAAGAAACTTGGAGG + Intronic
1091885690 12:4015548-4015570 GGCCAAGGACAGCAACATGGAGG - Intergenic
1093603221 12:21056668-21056690 GGACAGGGAAGGAACAATCGAGG + Intronic
1096106603 12:48999691-48999713 AGCCAGGGGCAGAACCCTGGTGG - Intergenic
1096487755 12:51995060-51995082 GGGCAGGGAAGGAATCCTGGTGG + Intronic
1096838948 12:54369601-54369623 GGCGAGGGAAAGGTCTATGGTGG + Exonic
1097696107 12:62776286-62776308 AGCAAGGGAAAGAGTCATGGGGG - Intronic
1098420388 12:70290508-70290530 GACCAGAGAAAGAATCATTGAGG - Intronic
1101156232 12:101930128-101930150 GCCCAGGGAAAGGACCATCTAGG + Intronic
1101549778 12:105751102-105751124 GGCCAGGGAAGGACTTATGGTGG + Intergenic
1101695646 12:107123331-107123353 GGAGAGGGAAGGAACCAAGGAGG - Intergenic
1103582019 12:121922511-121922533 GGCCAGGGAAAGCTTCCTGGAGG + Intronic
1105277499 13:18944351-18944373 GGCCAGGGAAAAAAGCGGGGAGG - Intergenic
1105771604 13:23617354-23617376 GGCCAGGGGGAGCACCAGGGAGG + Intronic
1105781416 13:23707953-23707975 GGCCAAGGAAAGAGCCATTTTGG - Intergenic
1107050144 13:36038265-36038287 GGGCAGGGATGGACCCATGGTGG - Intronic
1107788565 13:43978155-43978177 GGTCAGAGAATGAACCTTGGTGG - Intergenic
1108017867 13:46095151-46095173 GACCAGGGAAATAATGATGGGGG - Intronic
1108683011 13:52795381-52795403 AGCCAGGGAATGAACAATGACGG - Intergenic
1110129548 13:71990308-71990330 GTAGAGGGAAAGAAGCATGGAGG + Intergenic
1111965368 13:94856568-94856590 AGCCAGGGAAAGAACCTTCTGGG - Intergenic
1112023674 13:95393448-95393470 GGCCAAGGACAGTACCAAGGGGG + Intergenic
1113532258 13:111036912-111036934 GGACAGGAAAAAAACCAGGGCGG - Intergenic
1113643669 13:111976539-111976561 GGCCAGGAAAAGATCCCTGTAGG - Intergenic
1113843025 13:113371199-113371221 GGCCAGGGCAGGAAGCTTGGTGG + Intergenic
1113915895 13:113874127-113874149 GGCCAGAGAAAGAACCATCTGGG - Intergenic
1115794792 14:36922594-36922616 GGTCAGGAAAAGAACTATGAGGG + Intronic
1116330271 14:43587189-43587211 GGCCAGGGGAAGAAACAGGGTGG + Intergenic
1116904656 14:50392990-50393012 GGCCAGGGAGAGAAGGAAGGGGG - Intronic
1118245801 14:64109228-64109250 GGCCAGGGAAAAGACCCTAGAGG - Intronic
1119521177 14:75286585-75286607 GACCAGGGAAAGCCCCTTGGAGG - Intergenic
1119669076 14:76505193-76505215 GGACAGGTAGAGAACAATGGAGG - Intergenic
1120759662 14:88274133-88274155 GGCCAGGGAAAGAACCATGGCGG - Intronic
1120762020 14:88293597-88293619 GTCCAGGCAAAGAATCATGGTGG - Intronic
1120953809 14:90064041-90064063 GCTCAGGGGGAGAACCATGGGGG - Intronic
1121393515 14:93597006-93597028 GGCCACAGAAAGAAGCATAGAGG + Intronic
1121675893 14:95752347-95752369 GGCAAGGGAAAGAAGCAAGGGGG + Intergenic
1122361947 14:101172740-101172762 GGTGACGGAAAGAACCCTGGGGG - Intergenic
1122616581 14:103022103-103022125 GGCCAAGGACAGAACCCTGGGGG + Intronic
1122795296 14:104203085-104203107 GGCCAGGGAGGGAGCCAAGGAGG - Intergenic
1122962619 14:105103231-105103253 GGCCATGGAAAGAGACCTGGTGG + Intergenic
1124658750 15:31528320-31528342 GGCCAGGGACAGACCCAGAGGGG + Intronic
1125118403 15:36122823-36122845 AGCCAGGGAAGACACCATGGAGG + Intergenic
1125728635 15:41880812-41880834 GGTCAGGGAAGGCACCTTGGAGG - Intronic
1126527105 15:49668337-49668359 GGCCATGGAAATAAAAATGGAGG + Intergenic
1127966016 15:63923460-63923482 GGCCATGGGGAGAACCAGGGTGG + Intronic
1129034856 15:72642755-72642777 GGCCAGGGCAGGTACCATGTTGG + Intergenic
1129215026 15:74094461-74094483 GGCCAGGGCAGGTACCATGTTGG - Intergenic
1129671828 15:77611958-77611980 GGCCCTGGGAAGAACCCTGGTGG + Intergenic
1130298076 15:82661135-82661157 GGCCAAGGACAGAACCTTGGGGG - Intronic
1130895424 15:88166564-88166586 CCCCAGGGACGGAACCATGGAGG + Intronic
1131077035 15:89501870-89501892 GGCCAAGGAAGGCCCCATGGAGG + Intergenic
1133632466 16:7634355-7634377 GGCCAGTTAAAGATCCATGGAGG - Intronic
1134034677 16:11020691-11020713 GGGCAGGGAATGAACCAGGCAGG - Intronic
1138050356 16:53770249-53770271 AGGCAGGGAAAGAAGCAAGGAGG - Intronic
1138260223 16:55614612-55614634 AGCAAGGGAAAGATCCAGGGAGG + Intergenic
1138335470 16:56249514-56249536 GATCAGGGAAAGCACCAAGGGGG + Intronic
1139471217 16:67179107-67179129 GGCCAGAGAAAGAACCCTCAGGG - Intronic
1144258252 17:13491114-13491136 GGAAAGTGAAAGAAGCATGGAGG + Intergenic
1147791023 17:43014330-43014352 GGCCAGTGTGAGAACCTTGGCGG - Exonic
1148763679 17:50023094-50023116 AGCCAGGGAAGGAACCAGGAGGG - Intergenic
1149257242 17:54840639-54840661 GGCCAAAGAAAGTACAATGGTGG - Intergenic
1149651630 17:58279649-58279671 GCCGGGGGAAAGAACAATGGGGG + Intronic
1152015789 17:77749492-77749514 GGCCAGGGAGAGCACCAGTGTGG + Intergenic
1153393364 18:4589691-4589713 GGCCAGTGGAGGAAACATGGTGG + Intergenic
1157511731 18:48280198-48280220 GGGCAGGAAAGGTACCATGGAGG + Intronic
1160014384 18:75129176-75129198 GGGGAGGGAAAGAAGGATGGGGG + Intergenic
1162203134 19:9035735-9035757 GGCCAGGGATGGGACCCTGGAGG - Intergenic
1163170899 19:15530389-15530411 AGCCAGGGAAAGATTCCTGGAGG - Intronic
1163591487 19:18196517-18196539 GACCAGGGAAAGAAACACAGAGG - Exonic
1163665125 19:18599659-18599681 GGCCAGGGCCAGAGCCAAGGTGG + Exonic
1165714921 19:38038143-38038165 GGCCAGGGTAAGGAGCATGGAGG + Intronic
1165849266 19:38840018-38840040 AGCACGGGAAAGAACCAGGGGGG - Intronic
1166120126 19:40681295-40681317 GGTCAGGGCCAGGACCATGGAGG + Intronic
1166249982 19:41563404-41563426 AGCCAGGGAAGGAACCCTGGTGG + Intronic
1167172057 19:47839786-47839808 GGCCAGGGAAGGTCCCACGGAGG - Exonic
1167332347 19:48864084-48864106 GGCCAGGGGAAGAAGCCAGGAGG - Intronic
1168563575 19:57403950-57403972 GGCCAAGCACAGAGCCATGGTGG + Intronic
925034225 2:673704-673726 GCACAGGGAAAGAACCAGAGGGG + Intronic
925869148 2:8254049-8254071 GGCTAGGGAAGAAACCATGTGGG - Intergenic
927466450 2:23340367-23340389 GGCCAGGAAGAGACCCAGGGAGG + Intergenic
927702476 2:25276994-25277016 CACCAGGGACAGAACCACGGAGG - Intronic
927776181 2:25905298-25905320 TGCCAGGGAAAGATTCCTGGAGG - Intergenic
929605722 2:43232836-43232858 GGCCAGGGCCAGAGCGATGGAGG + Exonic
929811305 2:45191192-45191214 TGCCAGGGATTGAAACATGGAGG + Intergenic
930063136 2:47307479-47307501 GGCTAGTGAAATACCCATGGTGG + Intergenic
931288861 2:60855091-60855113 GGCCAAGAAAAGAACTGTGGTGG + Intergenic
931556973 2:63516921-63516943 GGACAGGGAGAGAAACAGGGAGG + Intronic
932476005 2:72006318-72006340 GGCCAGGGAAGGTATCCTGGTGG + Intergenic
932583181 2:73005849-73005871 GGCCAGGGAAAGATCTCTGCTGG + Intronic
932618967 2:73254856-73254878 GGCCAGGGAAGGCCCCCTGGGGG + Exonic
933638560 2:84734233-84734255 GGCCAGAGAATGAACCCGGGAGG - Intronic
935153550 2:100461838-100461860 GGCCAGGGAAAGCACCATAAAGG - Intergenic
935579780 2:104746501-104746523 GGCCAGGGAAGGCAGCATGCAGG - Intergenic
937279204 2:120705805-120705827 GGGCAGGGAAAGGACACTGGAGG - Intergenic
939606040 2:144255434-144255456 CGTCAGGAAAACAACCATGGCGG - Intronic
941434352 2:165450276-165450298 GGCAAGAGAAAGAACAATGATGG + Intergenic
941866389 2:170339112-170339134 GTCAAGGGAAAGAAAGATGGAGG + Intronic
942801501 2:179881448-179881470 GGACTGAGAAAGAACCTTGGGGG - Intergenic
944105519 2:196075595-196075617 GGCCCGGGAAATACCAATGGTGG + Intergenic
944414823 2:199470508-199470530 GGCGAGGGCAAGAAGCCTGGTGG + Intronic
946791161 2:223301656-223301678 CAACAGGTAAAGAACCATGGCGG + Intergenic
947332627 2:229046017-229046039 AGCCAGGGGCAGAACGATGGTGG - Intronic
948541907 2:238697314-238697336 GGCCCGGGAAGGAAGCAGGGTGG - Intergenic
948606428 2:239138763-239138785 GCCCAGGGACAGAACCAGGCAGG - Intronic
948606876 2:239141411-239141433 GGCCAGGGAAAGAAAGAGGATGG - Intronic
948839486 2:240642064-240642086 GGCCTGGGAAAGGAATATGGGGG + Intergenic
1168915443 20:1481845-1481867 GGCCAGGGAAAAAAACAGGAAGG - Intronic
1169618468 20:7477183-7477205 TGCCAGGGAAATATCCATGCTGG + Intergenic
1170356348 20:15496286-15496308 GTCCAGGGCACGATCCATGGAGG + Intronic
1170886079 20:20340726-20340748 TGCCATGGAAACAAACATGGGGG + Intronic
1171085532 20:22235180-22235202 GGATAGGGAAAGAACTATGAAGG - Intergenic
1171183157 20:23105708-23105730 GGCCGGGGAAAGAGCCAATGTGG + Intergenic
1172020661 20:31911532-31911554 GGCCAGGGGAAGAACCTGGGAGG - Intronic
1172146545 20:32762150-32762172 GGCCAGTGAAATCACCCTGGGGG - Intergenic
1172452349 20:35035310-35035332 TGCCAGGGAAAGAACAAGCGAGG + Intronic
1172794374 20:37527125-37527147 GGCCTGGAAAGGAAGCATGGGGG - Intronic
1173089603 20:39957879-39957901 GATGAAGGAAAGAACCATGGGGG + Intergenic
1173516094 20:43666771-43666793 AGCCAGGGAAAGCGCCAGGGCGG - Intergenic
1174117169 20:48234399-48234421 GGCCAGGCAAGGCACCCTGGGGG + Intergenic
1175642517 20:60642880-60642902 AGCCAGGGAAAGAAGCAGGCAGG - Intergenic
1176200268 20:63857007-63857029 TGCCAGGGCAGGAACCCTGGGGG + Intergenic
1176261769 20:64185633-64185655 GCCCAGGGGATGCACCATGGGGG + Intronic
1176370220 21:6057923-6057945 GGCCACGGAAAGCACCCTTGGGG - Intergenic
1179669504 21:42936562-42936584 TGCCAGGGAAAGAGCCAAGATGG - Intergenic
1179753299 21:43480618-43480640 GGCCACGGAAAGCACCCTTGGGG + Intergenic
1182240364 22:28911210-28911232 GGGGAGGGAAAGAACTTTGGAGG + Intronic
1183006690 22:34908847-34908869 GGCAGGTAAAAGAACCATGGCGG - Intergenic
1183469327 22:37997257-37997279 GGACAGAGAAAGAAACAAGGTGG - Intronic
1184115348 22:42418798-42418820 GGTCAGGGAAAGACCCCTGGGGG - Intronic
1184212096 22:43042104-43042126 GGCCAGGGAAGCAAACACGGGGG - Intronic
949542930 3:5048240-5048262 GGCCAGTGAATGAACCAAGCTGG - Intergenic
949942455 3:9165229-9165251 GGTCTGGGAAAGAGCCATGCTGG + Intronic
951640550 3:24830093-24830115 GGCCAGGGACCGAGCCCTGGAGG + Intergenic
951912595 3:27767266-27767288 GGCCAGAGAAGGAACAGTGGTGG + Intergenic
952228639 3:31405759-31405781 GGAAAGGGAGAAAACCATGGAGG - Intergenic
952744181 3:36762459-36762481 AGCCAAGCAAAGAACCATAGAGG + Intergenic
953274876 3:41485035-41485057 GCACATGGAAAGAACCATGTGGG - Intronic
955755684 3:62222979-62223001 GGTCAGGGAAAGCTCCCTGGAGG + Intronic
955889653 3:63636198-63636220 AGCCAGGAAAACATCCATGGAGG + Intergenic
956424280 3:69117172-69117194 GGCCAGGGTGAGAACGCTGGAGG - Intronic
958833833 3:99120528-99120550 GGCCAGGGACAGAACCTTGAGGG + Intergenic
960015665 3:112885186-112885208 TGCCAGTGAAAGAGCTATGGAGG + Intergenic
961198268 3:125022160-125022182 GGGAATGGAAAGAAACATGGTGG + Intronic
962387381 3:134943017-134943039 AGCCAGGGAAAGGATTATGGAGG + Intronic
962939316 3:140111246-140111268 GGGGAGGGAAAGAAGAATGGAGG - Intronic
963597407 3:147345823-147345845 GGCCAGTGAAAGATTCTTGGAGG - Intergenic
963902659 3:150747038-150747060 GTGCAGTGAAAGAACCCTGGCGG - Intronic
963966854 3:151381462-151381484 GGCCAGTGCAACAACCATGGAGG - Intronic
965468424 3:169060860-169060882 GGGCAAGGGATGAACCATGGAGG + Intergenic
967676222 3:192301842-192301864 GAGCAGGGAAAGAAACAAGGAGG + Intronic
967996704 3:195172399-195172421 GGCCAGGGGAAGTACCAAGCCGG + Intronic
968183217 3:196612584-196612606 GGCCAGTGGAAGAACACTGGAGG - Intergenic
968514003 4:1008814-1008836 GGCCAGGGAAAGACCCACCCAGG - Intergenic
968643537 4:1727203-1727225 TGCCAGAGAAAGAAGCCTGGAGG - Intronic
968787206 4:2631426-2631448 GCCCAGGGAACGAGGCATGGGGG + Intronic
969858495 4:10018643-10018665 TGCCGGGGAAAGAACCAGGAGGG - Intronic
970260272 4:14217321-14217343 GGCCAGAGAAGGGTCCATGGAGG - Intergenic
970458884 4:16253145-16253167 GCCCAGGGAAGGGACAATGGTGG - Intergenic
973717688 4:53693400-53693422 GGCCAGGCAAAGTACTATAGCGG + Intronic
976391675 4:84511989-84512011 GCCGAGAGAAAGGACCATGGTGG + Intergenic
978125892 4:105134981-105135003 TGCCAGTGTAAGAAACATGGCGG + Intergenic
979063230 4:116094803-116094825 GGCTAGGGAAAGGGACATGGAGG - Intergenic
981229859 4:142340168-142340190 TGGGAGGGAAATAACCATGGAGG + Intronic
983933252 4:173476197-173476219 GGCTGGGGGAAGAAGCATGGTGG + Intergenic
984806798 4:183758572-183758594 GGGCAGGGAAAGAGCAACGGTGG + Intergenic
986415939 5:7528227-7528249 GGCCTGGGAAGGGACCAGGGAGG - Intronic
987650178 5:20731009-20731031 GGCCAGAGAGAGGACCATAGTGG + Intergenic
988180205 5:27781687-27781709 GGGCAGGGAAAGAATAATGAGGG - Intergenic
988745381 5:34130458-34130480 GGCCAGAGAGAGGACCATAGTGG - Intergenic
990519081 5:56560415-56560437 GGCTACGGAAAGTACCATGGTGG - Intronic
990978212 5:61577529-61577551 GGGCAGGGAAAGACGCAGGGTGG - Intergenic
991010995 5:61882942-61882964 GGCCAGAGAAAGGACCAAGAAGG - Intergenic
992407287 5:76471972-76471994 AGCCAGGGAGAGAACAAGGGAGG - Intronic
997583136 5:135029471-135029493 GGACAGGAAAGGAACCATTGTGG - Intronic
997584354 5:135035609-135035631 TGCCTGGGAAAGAAGCAGGGAGG + Intronic
997595265 5:135103136-135103158 GGCCATGGAGAGAACTTTGGGGG + Intronic
998764056 5:145465099-145465121 GGCCATGAAAAGTACTATGGGGG - Intergenic
999839856 5:155413267-155413289 GGCCAGGGGAAGAGCACTGGTGG + Intergenic
1000134786 5:158336996-158337018 TGCCAGTGAAAGAGCTATGGTGG + Intergenic
1001296230 5:170501197-170501219 GGCCAGGGAGGGATCCCTGGAGG + Intronic
1002419260 5:179137193-179137215 GGCTAGGGCAACAGCCATGGAGG + Intronic
1003202425 6:3974248-3974270 GCCCAGGGAAACAAACATGTGGG - Intergenic
1003479222 6:6516070-6516092 AGCCAAGGAAAGACGCATGGTGG + Intergenic
1004017410 6:11744667-11744689 AGCCAGGCAAAGAAGCATGGAGG - Intronic
1004850156 6:19690955-19690977 TGCCAGGAAAAGGACCATGAAGG - Intergenic
1005085656 6:22004344-22004366 GGCGAGGGGAAGAAACTTGGAGG - Intergenic
1005543497 6:26838210-26838232 GGCCAGAGAGAGGACCATAGTGG - Intergenic
1007132127 6:39485010-39485032 GGCCAAGGAGAGAGCCCTGGGGG - Intronic
1007905867 6:45460172-45460194 GGCCAAGGACAGATCCCTGGGGG + Intronic
1009014327 6:57880379-57880401 GGCCAGAGAGAGGACCATAGTGG - Intergenic
1009538804 6:64925118-64925140 GGCCTAAGAAAGAATCATGGTGG + Intronic
1012928271 6:105289924-105289946 GTCCATAGAAATAACCATGGTGG + Intronic
1014894805 6:126888828-126888850 GACCAGGGAAGGCACCAGGGTGG + Intergenic
1015299424 6:131635562-131635584 GGCCTGGGAAAGAGTCTTGGTGG - Intronic
1016113346 6:140253423-140253445 GGCCAGGGAAATAAGTTTGGAGG - Intergenic
1017171970 6:151465415-151465437 TGCCAGGGAAGGGTCCATGGAGG + Intronic
1019173381 6:170147288-170147310 GGCCAAGGAAGGAGCCACGGAGG + Intergenic
1019573933 7:1727115-1727137 GGGCAGGGAAGGAACCAAGATGG - Intronic
1021292657 7:18865231-18865253 GGCCAGGGTGAGAACAGTGGAGG + Intronic
1021972372 7:25978088-25978110 GGGCAGGGAAAGAAAAAGGGAGG + Intergenic
1022814408 7:33900761-33900783 GGCCAGGGAAAGAGTGAAGGTGG + Intergenic
1022982735 7:35619607-35619629 GGCATGGGAAAGAAAAATGGCGG + Intergenic
1024060510 7:45694919-45694941 GGCTAGAGAAAGAACCATCTAGG - Intronic
1026206306 7:68260760-68260782 GGCCAGTAAAAGATCCAAGGAGG - Intergenic
1028093448 7:86731400-86731422 GGACATGGAAAGAATCATGGAGG - Intronic
1028418853 7:90610153-90610175 GATCAGGGAAGGAACTATGGGGG - Intronic
1032498653 7:132382291-132382313 GGCAAGGCAAACAACCATGAAGG - Intronic
1033007727 7:137585719-137585741 AGGCAGGGAAAGAATCAAGGAGG + Intronic
1033726725 7:144126622-144126644 GGCCATGAAAAGAACAATGAAGG - Intergenic
1035113873 7:156506625-156506647 GGCCAGACAAAGCTCCATGGAGG + Intergenic
1035684794 8:1515281-1515303 GGCCAGAGAAACCATCATGGAGG + Intronic
1037275288 8:17171924-17171946 TGCCAGTGAAAGAACCAAGATGG - Intronic
1037687682 8:21157619-21157641 GGACAGGGAAAGCCCCAGGGAGG - Intergenic
1038324871 8:26565420-26565442 GTCCAGGAAATGGACCATGGGGG + Intronic
1038351483 8:26779936-26779958 GGAAAGGGAAGAAACCATGGGGG + Intronic
1038493590 8:27986630-27986652 GTGTAGGGAAAGAACCGTGGTGG - Intronic
1039109871 8:34029838-34029860 GGCTAGGGAAAGACTCATAGTGG - Intergenic
1039885685 8:41652926-41652948 GGCCTGGCCAAGAACCCTGGTGG + Intergenic
1043469131 8:80544716-80544738 GTCCAGGGAAAGCTGCATGGGGG - Intergenic
1045052653 8:98340956-98340978 GCCCAGGGTAGGAACCCTGGTGG + Intergenic
1047489842 8:125365420-125365442 GGGCAGGGAAAATAGCATGGGGG - Intronic
1048948845 8:139476075-139476097 GGACAGGGAGTTAACCATGGCGG + Intergenic
1049424354 8:142531484-142531506 GGCCAGGGGAAGGGCCAAGGAGG + Intronic
1050103082 9:2138813-2138835 GGCCCTAGAAAGAACCATGTGGG + Intronic
1052370866 9:27663176-27663198 GGCAAGGGAAAGGAGGATGGGGG - Intergenic
1055279437 9:74657584-74657606 GGGCAGGAAAATAACCATAGAGG - Intronic
1055356017 9:75437863-75437885 AGACATGGAAAGAACCCTGGAGG - Intergenic
1055577181 9:77671758-77671780 AACCAGGGAATGAACCCTGGAGG + Intergenic
1055928793 9:81538581-81538603 GTCCAGGGAAGGAAACAGGGTGG + Intergenic
1056021323 9:82441099-82441121 GCCCAGGAGAACAACCATGGGGG + Intergenic
1057269704 9:93643947-93643969 GGGCAGGGAAAGGGCCAAGGGGG - Intronic
1057287816 9:93774516-93774538 GGACTGGCAAAGAGCCATGGGGG + Intergenic
1059339177 9:113587823-113587845 GGCCAGCTGGAGAACCATGGCGG - Intronic
1059842661 9:118235365-118235387 GGCCAGAGAAAGAAAAATGTGGG + Intergenic
1060041718 9:120306252-120306274 GCCCAGGGCATGAACCAGGGTGG + Intergenic
1060736659 9:126070521-126070543 GGCCAGGGAAAGGAACAGGCAGG - Intergenic
1061359579 9:130132436-130132458 TGGCAGGGAGAGAACCAGGGTGG - Intronic
1061719461 9:132542759-132542781 GGCCAGAGACAGGACCATGGAGG + Intronic
1185485290 X:477413-477435 TGCCAGTGAAAGAGCCATGATGG + Intergenic
1185772644 X:2776522-2776544 TGCCAGTGAAAGAGCCAAGGTGG + Intronic
1185785932 X:2890917-2890939 TGCCAGTGAAAGAGCCAAGGTGG + Intergenic
1187187088 X:16997402-16997424 GGCAAGGGAATGAACCACTGAGG - Intronic
1187716136 X:22104375-22104397 GGCCAGGGAGGGACCCTTGGAGG + Intronic
1189496583 X:41514300-41514322 GCCCAAGCAAGGAACCATGGTGG - Intergenic
1189984712 X:46544005-46544027 GGCAAGAGAAGGAAGCATGGGGG + Intronic
1192296376 X:69853380-69853402 GGCTAGGTTAAGAAACATGGAGG + Intronic
1193456901 X:81743073-81743095 GTCTAAGGAAAGAACCAAGGTGG - Intergenic
1193979904 X:88169216-88169238 TGCCAGCAAAAGAACTATGGTGG + Intergenic
1195172888 X:102286224-102286246 TGCCAGTGAAAGAGCTATGGTGG + Intergenic
1195185978 X:102400871-102400893 TGCCAGTGAAAGAGCTATGGTGG - Intronic
1199613137 X:149634553-149634575 AGCCAGGGAAGGAGCCTTGGTGG - Intergenic
1200100164 X:153686201-153686223 GGCCAGGGACAGGATCATGAGGG - Intronic
1200125244 X:153810395-153810417 GGCCAAGAAAAGACCCAGGGAGG + Intronic
1201502871 Y:14664346-14664368 GTCCAGTGAAAGCACCATGGAGG - Intronic