ID: 1120765178

View in Genome Browser
Species Human (GRCh38)
Location 14:88322327-88322349
Sequence CTGGAGCTGCGCCGCATGCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 136
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 129}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120765178 Original CRISPR CTGGAGCTGCGCCGCATGCC CGG (reversed) Intronic
900379334 1:2376080-2376102 CTGCTGCTGCACGGCATGCCTGG + Intronic
900613012 1:3552334-3552356 CTGGGGCTGCGCCTGATGCCAGG + Intronic
900659554 1:3775756-3775778 CTGGAGGTGAGCCCCAGGCCAGG - Intronic
900746199 1:4362307-4362329 CTGGGGCTGCCCCTCATGGCAGG - Intergenic
901400335 1:9011217-9011239 CTGGGGCTTCCCCGCAGGCCCGG + Intronic
901862895 1:12086137-12086159 CTGGAGCTGCGCGGGAACCCAGG + Intronic
903389324 1:22953251-22953273 CTGGCGCTGCGCCACCTGCACGG - Exonic
913026183 1:114843270-114843292 CTGGAGTTGGTCAGCATGCCTGG - Intergenic
915008060 1:152658852-152658874 CTGGAGCTGCTTCCCATGCAGGG + Intergenic
916352221 1:163863789-163863811 CTGCAGAAGCACCGCATGCCTGG - Intergenic
917927409 1:179800671-179800693 CTGGTGCTGGGCTCCATGCCAGG + Intronic
1064090344 10:12378028-12378050 TGTGAGCTGGGCCGCATGCCTGG - Intronic
1064645145 10:17453489-17453511 GTGCAGCCGCGCCCCATGCCCGG + Intronic
1067227561 10:44385615-44385637 CGGCGGCTGCGCCGCAAGCCGGG - Intronic
1067747659 10:48948323-48948345 CCAGAGCTGCACCCCATGCCAGG + Intronic
1069889494 10:71644216-71644238 CTGGAGCCCCGCGGCTTGCCTGG + Intronic
1070592516 10:77811094-77811116 CTGGAGCTGCTCTGCTTGGCTGG + Exonic
1073484335 10:103807114-103807136 CTGGAGCTGCGCTGTAAGTCTGG - Intronic
1074741318 10:116486947-116486969 CTGGGGACGGGCCGCATGCCTGG + Intergenic
1075882609 10:125866698-125866720 CTGGAGCTATGCCTCATGCAGGG - Intronic
1076738207 10:132468105-132468127 CTGGCGTTGCCCCGCCTGCCTGG - Intergenic
1076798091 10:132808513-132808535 CTGGAGCTGCGTCTCTTCCCGGG - Exonic
1077038701 11:507695-507717 CTGGGGCGGCTCCGCATGTCGGG + Intergenic
1077460887 11:2708833-2708855 CTGGAGCTGCCCCTGTTGCCAGG - Intronic
1083176132 11:60951511-60951533 CGGGAGCAGCCCCGCGTGCCCGG - Exonic
1084112506 11:67023255-67023277 CCGGAGCTGCGCCGCAGTCCGGG - Intronic
1085044334 11:73344443-73344465 CTGGCGCTGTGCCTGATGCCGGG - Intronic
1085283027 11:75343068-75343090 ATGGAGCTCAGCGGCATGCCAGG + Intronic
1089757014 11:120694704-120694726 CTGGAGCTCTGCTGCATCCCAGG - Intronic
1097166481 12:57089008-57089030 CCGGAGCTGCGCTGGCTGCCGGG - Exonic
1098442776 12:70535679-70535701 CTGGACCTGCCCCTCATCCCAGG - Intronic
1102464234 12:113119198-113119220 CTGGAGCTGCGGGAGATGCCAGG - Exonic
1103604700 12:122078396-122078418 CTGTGGCTTCGCCGCAGGCCCGG - Intergenic
1103698525 12:122835578-122835600 CGGGTGCTGAGCCGCAGGCCGGG + Exonic
1103912442 12:124359903-124359925 CGGGAGCTGAGCTGCAAGCCAGG + Intronic
1103916847 12:124380211-124380233 CTGGAGCTGGGCCTCATGGAGGG + Intronic
1104424815 12:128667435-128667457 CTGGAGCTGGGCTGCAATCCAGG - Intronic
1115651087 14:35403673-35403695 CAGCAGGTGCGCCGCTTGCCTGG - Exonic
1117332701 14:54728965-54728987 CTTGAGCTGAACCGCAGGCCAGG - Intronic
1120765178 14:88322327-88322349 CTGGAGCTGCGCCGCATGCCCGG - Intronic
1120811646 14:88809315-88809337 CTGGAGCTGCACTGCTTTCCTGG + Intergenic
1123709875 15:22979925-22979947 CTGGAGCTGTGCCATGTGCCGGG + Intronic
1124611887 15:31215065-31215087 CTGGAGCTGGGCCTCCTTCCTGG - Intergenic
1128093198 15:64933009-64933031 CTGGAGCTGCTCATCACGCCAGG + Intronic
1129628296 15:77229510-77229532 CTTGAGCTGAGCCTCATGCATGG - Intronic
1132872713 16:2122889-2122911 TGGGAGCTGCTCCCCATGCCTGG - Intronic
1135597400 16:23754916-23754938 CTGGAGCTTGGCCGCGCGCCAGG + Exonic
1137671472 16:50281989-50282011 CTGGAGCTGCGTGGCGTCCCAGG + Intronic
1138501461 16:57447557-57447579 CTGCAGCTGCGATGCCTGCCCGG + Exonic
1141652686 16:85401994-85402016 CAGCAGCTGCGCTCCATGCCAGG + Intergenic
1141898115 16:86971630-86971652 ATGGAGCTCTGCTGCATGCCAGG + Intergenic
1141983587 16:87565319-87565341 CTGGAGATGCCCCGCAGGGCTGG - Intergenic
1144171860 17:12665924-12665946 CAGGAGCAGCGCGGCATCCCAGG - Intronic
1144520966 17:15951951-15951973 CTGCAGCAGCTCTGCATGCCTGG + Intronic
1144724667 17:17495904-17495926 ATGGAGAGGCGCCGCATGGCGGG + Exonic
1145057803 17:19714686-19714708 CTGGAGCTGGGCAGGAAGCCAGG - Intronic
1146400180 17:32495417-32495439 CTGGAGCTGGGCCGCTTGGCTGG + Intronic
1146576339 17:33995163-33995185 CTGGAGCTGTGAAGCATGGCAGG + Intronic
1147139310 17:38452490-38452512 CTGGAGCTGCCCCGCTTTCCTGG + Intronic
1150280737 17:63928544-63928566 CTGGAACGGGGCTGCATGCCAGG - Intergenic
1151674401 17:75590137-75590159 CTGGAGCTGAGCCTCCGGCCGGG + Intergenic
1152630644 17:81409373-81409395 CTGGAGCTGCGCCGGCTGAGTGG + Intronic
1152778277 17:82215421-82215443 CTTCAGCTGAGCCACATGCCCGG + Intergenic
1152911981 17:83010176-83010198 CTGGAGAAGAGCCGCCTGCCTGG - Intronic
1156499645 18:37549415-37549437 CAGGGGCTGCCCCGCAGGCCAGG + Intronic
1160919923 19:1514477-1514499 CGGGCGCGGCGCCTCATGCCTGG + Intergenic
1161360900 19:3849150-3849172 CTGGTGCTGCTCAGCACGCCTGG - Intronic
1162785834 19:13034225-13034247 CTTGAGCTGAGCCGCAAGCTGGG - Intronic
1163529723 19:17842353-17842375 CTGGGGCTGCTCCGCGTGGCTGG - Exonic
1165097382 19:33417018-33417040 CAGGAGCTGGGCCGTGTGCCCGG - Intronic
925971427 2:9109305-9109327 CAGGAGCTGTGGCTCATGCCTGG + Intergenic
926944121 2:18168940-18168962 CAGGCTCTGCGCCACATGCCAGG - Intronic
928550219 2:32363052-32363074 CTGGTGCTGTGGCTCATGCCTGG + Intronic
930177412 2:48314861-48314883 CGGGAGCTGCGCCGCGGGCTGGG - Intronic
930636295 2:53809606-53809628 CGGGAGTGGTGCCGCATGCCTGG + Intronic
937078397 2:119123735-119123757 CTGGAGGAGCCCCACATGCCTGG + Intergenic
942863772 2:180647884-180647906 CTGGAGCTTCCCCTCATGCTCGG + Intergenic
943664657 2:190596496-190596518 CTGGACCTGTGCCCCATGTCAGG + Intergenic
944172976 2:196799736-196799758 CTGCAGCTGCGGCGCAGACCGGG - Intergenic
948813934 2:240500118-240500140 CTGGTGCTGTGCCGCAGGACCGG - Exonic
948912671 2:241012174-241012196 CTGGGGCTGGGCCACCTGCCTGG - Intronic
1169210663 20:3764674-3764696 CTGGTGCTGCGCTGAGTGCCGGG - Intronic
1171249436 20:23637346-23637368 CTCGAGCTGCGCCGCAGCGCGGG - Intronic
1172482217 20:35277807-35277829 CTGGGGCTGGGGCGGATGCCGGG + Intergenic
1172911515 20:38412985-38413007 CTGGAGCTGTGTCACAGGCCTGG + Intergenic
1173471438 20:43326353-43326375 CTGGAGCTGGGCAGCCTGCAGGG - Intergenic
1174292946 20:49521824-49521846 CTGGAGCTGTGCAGCATGGAAGG + Intronic
1175397275 20:58675137-58675159 CGGGAGCTGCTCCCCATGACCGG + Intronic
1175698167 20:61117908-61117930 TTGGGGCTGCCCCCCATGCCAGG + Intergenic
1175818587 20:61896396-61896418 GTGCAGCTGCGCCCCAGGCCTGG - Intronic
1175922197 20:62455526-62455548 CTGAAGCTGCCCCGCCTCCCAGG + Intergenic
1175979771 20:62732455-62732477 CTGGAGCAGCCTCGCATGCCTGG + Intronic
1176011311 20:62897849-62897871 GTTGAGGTGCACCGCATGCCGGG + Intronic
1178493800 21:33070751-33070773 CAGGAGCTGCGCCGCGCGCTGGG + Exonic
1183291162 22:37002767-37002789 CTGGGGCTAAGCCACATGCCTGG + Intronic
1184033918 22:41909879-41909901 CTGGCGCCGGGCCGCGTGCCCGG + Exonic
1184127791 22:42500364-42500386 CTGGAGTTGCGGGGCTTGCCTGG + Intergenic
1184136660 22:42553882-42553904 CTGGAGTTGCGGGGCCTGCCTGG + Intronic
1185027541 22:48424404-48424426 CCGGAGCTGCTGCCCATGCCGGG + Intergenic
953027369 3:39152976-39152998 CGGGAGCTGCGGCGTGTGCCGGG - Intronic
954200776 3:49021953-49021975 CTGGAGCTGCGCCGGAGGTCGGG + Exonic
961599855 3:128052273-128052295 CAGGAGCCCCGCTGCATGCCGGG + Intronic
961830089 3:129618901-129618923 CTTGAGCTGAGCCGGATGCATGG - Intergenic
968534378 4:1113894-1113916 CGGGAGCTGGGCCGGAGGCCAGG + Intergenic
968844327 4:3031524-3031546 GGGGAGCTGGGCTGCATGCCAGG + Intronic
978361005 4:107931426-107931448 CTGGAGGCGCGCCGGCTGCCTGG - Exonic
979582787 4:122379621-122379643 CTGCTGCTGCGCCTCAGGCCGGG - Intronic
981093506 4:140756436-140756458 CTGGCGCTGAGCCGGATCCCGGG - Intergenic
984578197 4:181475962-181475984 CTGGAGCCGCACCGCCTGCTGGG - Intergenic
985791602 5:1931164-1931186 CAGGGGCTGCGCCGCGTCCCCGG + Intergenic
990528236 5:56649826-56649848 CTGCAGCTGCTCCTCATGCTGGG - Intergenic
997087362 5:130817672-130817694 CTGTAGCTACTCCCCATGCCAGG + Intergenic
1001565438 5:172696698-172696720 CAGGAGCAGCCCCGCATTCCAGG + Intergenic
1003847212 6:10185717-10185739 CGGGAGATGCACCACATGCCAGG - Intronic
1012701185 6:102459136-102459158 CTGCAGCTGCCCCTCCTGCCAGG - Intergenic
1015642597 6:135351850-135351872 CTGGACCTGCGCCTCCTTCCTGG + Intronic
1017846750 6:158265175-158265197 GGGGAGCTGAGCCCCATGCCAGG + Intronic
1018531526 6:164768877-164768899 CTGGAGCTGCTCGAGATGCCTGG - Intergenic
1018762403 6:166903714-166903736 CTGGAACTCCGCCACATCCCAGG + Intronic
1019381651 7:727278-727300 CTGCAGCTGCGCCGCCGCCCTGG + Exonic
1027124502 7:75546732-75546754 CTGGAGTTGGGACACATGCCTGG + Intronic
1030185121 7:106754195-106754217 CTGGAGCTGCGTCATAGGCCAGG - Intergenic
1039454483 8:37697961-37697983 CTGGAGCTGGGGGGCTTGCCCGG - Exonic
1040299964 8:46182889-46182911 CTGAAGCTTTACCGCATGCCTGG + Intergenic
1040307646 8:46220504-46220526 CTGAAGCTTCACAGCATGCCCGG - Intergenic
1040464064 8:47678441-47678463 CAGGAGCTGTGGCACATGCCAGG + Intronic
1048524423 8:135188177-135188199 CTGGAGCCCAGCCCCATGCCTGG - Intergenic
1048816506 8:138339467-138339489 CTGAAGCTGGGCAGAATGCCAGG + Intronic
1048974095 8:139661628-139661650 CTGGAGCTGGGCCGTCAGCCTGG - Intronic
1053139431 9:35673602-35673624 CTGGAGCTGGGAAGCAGGCCAGG + Intronic
1054274222 9:63052611-63052633 CTGGGGCTGTGCTGCCTGCCCGG - Intergenic
1054400619 9:64712358-64712380 CTGGGGCTGTGCTGCCTGCCCGG + Intergenic
1054434225 9:65196673-65196695 CTGGGGCTGTGCTGCCTGCCCGG + Intergenic
1054496163 9:65825007-65825029 CTGGGGCTGTGCTGCCTGCCGGG - Intergenic
1192142801 X:68659815-68659837 CTGGAGCAGCCCTGCAGGCCAGG + Intronic
1200234916 X:154463625-154463647 CCAGAGCTGCGCAGCCTGCCTGG + Exonic