ID: 1120765331

View in Genome Browser
Species Human (GRCh38)
Location 14:88323188-88323210
Sequence AGTGTCACTCCAGCCCCCGA AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 124
Summary {0: 1, 1: 0, 2: 2, 3: 10, 4: 111}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120765328_1120765331 10 Left 1120765328 14:88323155-88323177 CCTGAAGGCTGGGGCTACGGAGA 0: 1
1: 0
2: 1
3: 38
4: 551
Right 1120765331 14:88323188-88323210 AGTGTCACTCCAGCCCCCGAAGG 0: 1
1: 0
2: 2
3: 10
4: 111

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120765331 Original CRISPR AGTGTCACTCCAGCCCCCGA AGG Exonic
900431912 1:2606615-2606637 GGTGCCACTCCTGCCCCCGGGGG + Intronic
901026615 1:6281807-6281829 TGTGTCACTGGAGCCCCTGAGGG - Intronic
902465356 1:16613861-16613883 GGGGTCGCTCCAGCCCCAGAGGG - Intergenic
902679480 1:18032939-18032961 AGTGTCACTCCAGCCAGAGCGGG - Intergenic
903057026 1:20643184-20643206 AGTGACACTCGAGACCCAGATGG - Intronic
910749635 1:90615027-90615049 AATGTCACTGCAGGCCCCTAGGG + Intergenic
913491585 1:119384838-119384860 ATTGTCATTGCAGCTCCCGAAGG + Exonic
920959455 1:210651653-210651675 AATGTCCCTCCAGCCCTAGAAGG - Intronic
921266698 1:213426372-213426394 CGTGCCACCCCAGTCCCCGAGGG - Intergenic
924441273 1:244087395-244087417 GGCGTCACTCCAGCCTCCGGTGG - Intergenic
1064263860 10:13808788-13808810 AGGGTCTCTCCAGCCACAGAAGG - Intronic
1066459241 10:35598636-35598658 AGTGTCACTTTAGCCTGCGAGGG + Intergenic
1069617394 10:69814823-69814845 AGTCCCACTCCAGCCTCCAAGGG + Intronic
1069870510 10:71529983-71530005 AGTCTCCATCCAGCCCCAGAGGG - Intronic
1069870956 10:71532584-71532606 AGTCTCCATCCAGCCCCAGAGGG - Intronic
1077170197 11:1162672-1162694 TGTGCAACTCCAGCCCTCGAGGG + Intronic
1080418784 11:32092275-32092297 AGTCTCACTCTAGCCCCGGCTGG - Intronic
1080720160 11:34840820-34840842 AGTGTAATGCCAGCCCCAGAAGG + Intergenic
1082889156 11:58119754-58119776 AGTGAGACTCCAGCCCCAGATGG - Intronic
1083936097 11:65870939-65870961 AGTGTCTCTGCAGCAACCGAGGG + Intronic
1084445380 11:69200597-69200619 AGTGACAGGGCAGCCCCCGAAGG - Intergenic
1084529442 11:69718303-69718325 AGTCTCACACCAGCCCACGAGGG + Intergenic
1087887811 11:103500102-103500124 AGTGTCACTTGAGCCCTGGAGGG + Intergenic
1088786507 11:113186922-113186944 AGTGTCACTCATGTCCCCTAAGG - Intronic
1089518532 11:119048831-119048853 GGCGTCGCTCCAGCCCCAGAGGG - Exonic
1090167986 11:124571497-124571519 AGTCTCACTCCAGCCCAGGCTGG + Intergenic
1098595915 12:72272989-72273011 AGTGCCACGCCAGGCGCCGACGG + Exonic
1101842740 12:108339782-108339804 AGGGGCACAGCAGCCCCCGAGGG - Intergenic
1102419855 12:112794889-112794911 AGTGTCTCTCCAGCCCGTGCTGG + Intronic
1102461410 12:113101954-113101976 TGGGTCACTCCAGTCCCCCAGGG + Exonic
1102985524 12:117274738-117274760 AGTGTCACTCCAGCCCAGGCTGG - Intronic
1104006413 12:124895909-124895931 AGAGTCACTCGAGCCCACGGAGG + Intergenic
1107045496 13:35988142-35988164 AGTGGCACTCCAGCCACTCAGGG - Intronic
1111950112 13:94703296-94703318 AATGTGGCTCCAGCCCCAGAGGG + Intergenic
1113379366 13:109787556-109787578 GGCGTCTCTCCAGCCCCCGCAGG + Intergenic
1114459583 14:22877911-22877933 AGAGACCCTCCAGCCCCCAAGGG + Exonic
1117025988 14:51620699-51620721 AGTGGCAGTCCAGCCCCAGCAGG + Intronic
1117108425 14:52422811-52422833 AAGGTCACACCAGCCCCAGATGG - Intergenic
1120765331 14:88323188-88323210 AGTGTCACTCCAGCCCCCGAAGG + Exonic
1121438380 14:93933567-93933589 GGGGTCTCTCCAGGCCCCGAGGG - Intergenic
1122052568 14:99070081-99070103 TGTGTCACTCAAGCCCCTGGAGG + Intergenic
1124607384 15:31179808-31179830 AGTGTGTCTCCAGCCACAGAGGG - Intergenic
1128994767 15:72288442-72288464 ACTGTTCCTCCAGGCCCCGAAGG - Exonic
1130284003 15:82540604-82540626 GGTGTCTGTCCCGCCCCCGACGG + Intronic
1132288978 15:100686130-100686152 AGTGTCCCTTCAGCCTCCAACGG - Intergenic
1132352683 15:101149515-101149537 AATGTCTCTCCAGCCCGTGAAGG - Intergenic
1134691898 16:16196536-16196558 AGTAGCACTCCTGCCCCAGAGGG - Intronic
1139923777 16:70474784-70474806 CGTGTCACTCCAGCCCCCTATGG - Exonic
1141337612 16:83171644-83171666 AGTGTCACTAAATCCCCTGATGG - Intronic
1141650786 16:85391944-85391966 GGAGTCACTCCAGCCCAAGAAGG + Intergenic
1141877786 16:86837993-86838015 AGTGTCCCTCGAGCCCCAGAAGG + Intergenic
1144465213 17:15491561-15491583 AGTCTTACTCCAGCCCCTGAAGG - Intronic
1147610398 17:41798627-41798649 AGTCTCACTCCAGCCCAGGCTGG - Intergenic
1148129496 17:45254532-45254554 AGTGTCACTTGGGCCCCAGAGGG + Intronic
1148499488 17:48078817-48078839 AGTCTCACTCCAGCCCAGGCTGG + Intronic
1148909723 17:50934902-50934924 AGTGTCACTCCCACCCCCACTGG - Intergenic
1149538386 17:57450211-57450233 GTTGTTACTCCAGCCCCAGAAGG - Intronic
1160527867 18:79547927-79547949 CTTGTCACCCCATCCCCCGAAGG + Intergenic
1160528316 18:79549788-79549810 AGTGTCACCTCATCCCCCGGGGG + Intergenic
1161684721 19:5697093-5697115 AGTATCACCCCAGCCCTTGAGGG - Intronic
1163298119 19:16425392-16425414 CCTGTCACTGCAGCCCCCAAAGG - Intronic
1164986044 19:32649531-32649553 AGGGTCCCTCCAGCCCCCCACGG + Intronic
1165900118 19:39165576-39165598 AGTGTCACCTCAGCCCTCCAGGG + Intronic
925141531 2:1553142-1553164 AGACTCACTGCAGCCCCAGAGGG - Intergenic
925762365 2:7197955-7197977 GATGTCACTCCAGCCTCCCAAGG + Intergenic
946147623 2:217742970-217742992 TGTTTAACTCCAGCCCCGGAGGG + Intronic
947910044 2:233794730-233794752 AGCCTCACTGCAGCCTCCGAGGG - Intronic
948577913 2:238965969-238965991 ACTGGCCCTCCAGCCCCCGTGGG + Intergenic
1170907640 20:20530291-20530313 AGTGTCCCTCCAGCCACAGCAGG - Intronic
1173265128 20:41472212-41472234 AGTCTCACTCCATTCCCCCAGGG - Intronic
1174003519 20:47392082-47392104 AGAGTCACTCCAGCTCCTGCAGG + Intergenic
1181831951 22:25566812-25566834 AGTGTCCCTCCACCACCCAAAGG + Intronic
1181952294 22:26563356-26563378 AGTCTCACTCCAGCCCAGGCTGG + Intronic
1182856088 22:33518760-33518782 AGTGTAACTGCACCCCCTGAGGG + Intronic
954325183 3:49859577-49859599 AGCATCACTCCAGCCACTGATGG - Exonic
954325189 3:49859601-49859623 AGTGTCACCCCAGCCACCGATGG - Exonic
954325195 3:49859625-49859647 AGTGCCACCCCAGCCACTGATGG - Exonic
954325201 3:49859649-49859671 AGTGCCACCCCAGCCACAGATGG - Exonic
955716399 3:61834781-61834803 AGTCTCACTCCAGCCCAGGCTGG - Intronic
956563971 3:70615036-70615058 GGGGCCACTCCAGCCCCCAATGG - Intergenic
966780949 3:183583886-183583908 AGAGTCACACCAGCCCCACAGGG + Intergenic
972023893 4:34352423-34352445 AGTCTCACTCCAGCCTGGGAAGG + Intergenic
972773164 4:42217429-42217451 TGTGTCACTCCTGACCCCGTGGG - Intergenic
982401930 4:154977609-154977631 AGTGGGACTCCAGCCTCCTACGG - Intergenic
985571123 5:645874-645896 AGCGTCACTCCTGCTCCCGTCGG + Intronic
985571132 5:645939-645961 AGCGTCACTCCTGCTCCCGTTGG + Intronic
995185588 5:109267441-109267463 AGTGCCAAGCCAGCCCCCCATGG + Intergenic
995441083 5:112193094-112193116 AGTGTAATTCCAGCCTCAGAAGG + Intronic
999286435 5:150396888-150396910 AGGGTCCCTCCCGCCCCCGTGGG - Intronic
1000826227 5:166047853-166047875 AGTATCACTCCATCCCACTATGG + Intergenic
1001551118 5:172602941-172602963 AGTGTCCCTCCAGGCCCCCTCGG + Intergenic
1002048204 5:176553836-176553858 AGTGCCACCCCTACCCCCGAGGG + Intronic
1002375462 5:178785690-178785712 AGTCTCACTCCAGCCCAGGCTGG - Intergenic
1003126317 6:3358855-3358877 ACCATCCCTCCAGCCCCCGATGG - Intronic
1005221256 6:23591355-23591377 AGTCTCACTCCAGCCCAAGCTGG - Intergenic
1006195069 6:32235171-32235193 AGTGTCACTGGAGACCCCGTGGG - Intergenic
1008727473 6:54440638-54440660 TGTGTCACTCCATCCCCAGCTGG - Intergenic
1013100817 6:106984925-106984947 AGTCTCACTCCAGCCCAGGCTGG - Intergenic
1014080159 6:117277010-117277032 TATTTCACTCCAGCCCCAGAGGG + Intergenic
1016461754 6:144285856-144285878 AATGTGACTACAGCCCCCGAGGG + Intronic
1025937559 7:66049372-66049394 AGTCTCACTCCAGCCCAGGCTGG + Intergenic
1026355612 7:69554394-69554416 AGGGTCACTTGAGCCCCAGAAGG + Intergenic
1027423268 7:78037754-78037776 AGTGTCAGTGCAGCACCCCAGGG + Intronic
1032280023 7:130492504-130492526 GGTGTCACTCCTGCCCGCAATGG + Intronic
1035039745 7:155919353-155919375 AGTGACACTCCATCTCCCGCGGG - Intergenic
1036512632 8:9414616-9414638 AGTGTGACTCCAGGCCAGGAGGG - Intergenic
1046718709 8:117595331-117595353 ACTGTCTCTCCAGCCACAGAAGG - Intergenic
1050652797 9:7791247-7791269 AGTGGGTCTTCAGCCCCCGAGGG - Intergenic
1053651226 9:40171570-40171592 AGTGAAACTCAAGCCCTCGAAGG + Intergenic
1053901618 9:42800924-42800946 AGTGAAACTCAAGCCCCCGAAGG + Intergenic
1054533354 9:66204633-66204655 AGTGAAACTCAAGCCCTCGAAGG - Intergenic
1058756826 9:108090284-108090306 AGTGTGACTCCAGCTCCCAATGG - Intergenic
1059434295 9:114266959-114266981 ACTGTCCATCCAGCCCCCAAGGG + Intronic
1060069522 9:120534027-120534049 AGTGTCAATCCATTCCCCAAGGG + Intronic
1060596370 9:124851580-124851602 ACTGTCACTCCATTCCCTGAAGG - Intergenic
1061520863 9:131117084-131117106 AATGTCACTCCAGCCCGAGGCGG - Intronic
1185754865 X:2645058-2645080 AGTCTCACTCCAGCCCGGGCTGG - Intergenic
1187460307 X:19480788-19480810 AGTTTCACTCCAGCCCAGGCTGG - Intronic
1189968922 X:46398461-46398483 AATGTCACTCCTGCCCCCTTAGG + Intergenic
1190426358 X:50337353-50337375 GCTGTCACTCCACCCACCGAGGG - Intronic
1190777929 X:53569113-53569135 AGTGTCACTTCAGCCCAGGAAGG - Intronic
1191257361 X:58285420-58285442 AGTGTCACTCAGTCCCCCAAGGG - Intergenic
1200045163 X:153397147-153397169 AGTGCCCCTGCAGGCCCCGAAGG - Intergenic
1200217016 X:154372351-154372373 AGTGGCATTCCAGACCCAGAGGG + Intronic