ID: 1120771255

View in Genome Browser
Species Human (GRCh38)
Location 14:88382954-88382976
Sequence ATCATGGTGGAAGGGCAAAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 4178
Summary {0: 15, 1: 34, 2: 223, 3: 1338, 4: 2568}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120771255_1120771261 -9 Left 1120771255 14:88382954-88382976 CCCCTTTGCCCTTCCACCATGAT 0: 15
1: 34
2: 223
3: 1338
4: 2568
Right 1120771261 14:88382968-88382990 CACCATGATAGTGTTTCCTGAGG No data
1120771255_1120771269 24 Left 1120771255 14:88382954-88382976 CCCCTTTGCCCTTCCACCATGAT 0: 15
1: 34
2: 223
3: 1338
4: 2568
Right 1120771269 14:88383001-88383023 CATGCTTTCTGTACAGCCTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120771255 Original CRISPR ATCATGGTGGAAGGGCAAAG GGG (reversed) Intergenic
Too many off-targets to display for this crispr