ID: 1120771255 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 14:88382954-88382976 |
| Sequence | ATCATGGTGGAAGGGCAAAG GGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1120771255_1120771261 | -9 | Left | 1120771255 | 14:88382954-88382976 | CCCCTTTGCCCTTCCACCATGAT | No data | ||
| Right | 1120771261 | 14:88382968-88382990 | CACCATGATAGTGTTTCCTGAGG | No data | ||||
| 1120771255_1120771269 | 24 | Left | 1120771255 | 14:88382954-88382976 | CCCCTTTGCCCTTCCACCATGAT | No data | ||
| Right | 1120771269 | 14:88383001-88383023 | CATGCTTTCTGTACAGCCTATGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1120771255 | Original CRISPR | ATCATGGTGGAAGGGCAAAG GGG (reversed) | Intergenic | ||