ID: 1120771257

View in Genome Browser
Species Human (GRCh38)
Location 14:88382956-88382978
Sequence CTATCATGGTGGAAGGGCAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120771257_1120771269 22 Left 1120771257 14:88382956-88382978 CCTTTGCCCTTCCACCATGATAG No data
Right 1120771269 14:88383001-88383023 CATGCTTTCTGTACAGCCTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120771257 Original CRISPR CTATCATGGTGGAAGGGCAA AGG (reversed) Intergenic
No off target data available for this crispr