ID: 1120771259

View in Genome Browser
Species Human (GRCh38)
Location 14:88382963-88382985
Sequence GGAAACACTATCATGGTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120771259_1120771269 15 Left 1120771259 14:88382963-88382985 CCTTCCACCATGATAGTGTTTCC No data
Right 1120771269 14:88383001-88383023 CATGCTTTCTGTACAGCCTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120771259 Original CRISPR GGAAACACTATCATGGTGGA AGG (reversed) Intergenic
No off target data available for this crispr