ID: 1120771260

View in Genome Browser
Species Human (GRCh38)
Location 14:88382967-88382989
Sequence CTCAGGAAACACTATCATGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120771260_1120771269 11 Left 1120771260 14:88382967-88382989 CCACCATGATAGTGTTTCCTGAG No data
Right 1120771269 14:88383001-88383023 CATGCTTTCTGTACAGCCTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120771260 Original CRISPR CTCAGGAAACACTATCATGG TGG (reversed) Intergenic
No off target data available for this crispr