ID: 1120771263

View in Genome Browser
Species Human (GRCh38)
Location 14:88382984-88383006
Sequence AGCATGGCTGGGGAGGCCTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 16290
Summary {0: 1147, 1: 2922, 2: 4399, 3: 4524, 4: 3298}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120771263_1120771269 -6 Left 1120771263 14:88382984-88383006 CCTGAGGCCTCCCCAGCCATGCT 0: 1147
1: 2922
2: 4399
3: 4524
4: 3298
Right 1120771269 14:88383001-88383023 CATGCTTTCTGTACAGCCTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120771263 Original CRISPR AGCATGGCTGGGGAGGCCTC AGG (reversed) Intergenic
Too many off-targets to display for this crispr