ID: 1120771269

View in Genome Browser
Species Human (GRCh38)
Location 14:88383001-88383023
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120771262_1120771269 8 Left 1120771262 14:88382970-88382992 CCATGATAGTGTTTCCTGAGGCC No data
Right 1120771269 14:88383001-88383023 CATGCTTTCTGTACAGCCTATGG No data
1120771257_1120771269 22 Left 1120771257 14:88382956-88382978 CCTTTGCCCTTCCACCATGATAG No data
Right 1120771269 14:88383001-88383023 CATGCTTTCTGTACAGCCTATGG No data
1120771263_1120771269 -6 Left 1120771263 14:88382984-88383006 CCTGAGGCCTCCCCAGCCATGCT No data
Right 1120771269 14:88383001-88383023 CATGCTTTCTGTACAGCCTATGG No data
1120771255_1120771269 24 Left 1120771255 14:88382954-88382976 CCCCTTTGCCCTTCCACCATGAT No data
Right 1120771269 14:88383001-88383023 CATGCTTTCTGTACAGCCTATGG No data
1120771258_1120771269 16 Left 1120771258 14:88382962-88382984 CCCTTCCACCATGATAGTGTTTC No data
Right 1120771269 14:88383001-88383023 CATGCTTTCTGTACAGCCTATGG No data
1120771259_1120771269 15 Left 1120771259 14:88382963-88382985 CCTTCCACCATGATAGTGTTTCC No data
Right 1120771269 14:88383001-88383023 CATGCTTTCTGTACAGCCTATGG No data
1120771256_1120771269 23 Left 1120771256 14:88382955-88382977 CCCTTTGCCCTTCCACCATGATA No data
Right 1120771269 14:88383001-88383023 CATGCTTTCTGTACAGCCTATGG No data
1120771260_1120771269 11 Left 1120771260 14:88382967-88382989 CCACCATGATAGTGTTTCCTGAG No data
Right 1120771269 14:88383001-88383023 CATGCTTTCTGTACAGCCTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120771269 Original CRISPR CATGCTTTCTGTACAGCCTA TGG Intergenic