ID: 1120772425

View in Genome Browser
Species Human (GRCh38)
Location 14:88395193-88395215
Sequence GTGGTATAGTTATCAAAACC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 181
Summary {0: 1, 1: 0, 2: 5, 3: 31, 4: 144}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120772421_1120772425 20 Left 1120772421 14:88395150-88395172 CCTGTACTCTGCTCTTCCACTAA 0: 1
1: 0
2: 1
3: 15
4: 201
Right 1120772425 14:88395193-88395215 GTGGTATAGTTATCAAAACCAGG 0: 1
1: 0
2: 5
3: 31
4: 144
1120772419_1120772425 28 Left 1120772419 14:88395142-88395164 CCATATACCCTGTACTCTGCTCT 0: 1
1: 0
2: 0
3: 19
4: 247
Right 1120772425 14:88395193-88395215 GTGGTATAGTTATCAAAACCAGG 0: 1
1: 0
2: 5
3: 31
4: 144
1120772422_1120772425 4 Left 1120772422 14:88395166-88395188 CCACTAATGTTAAAAATCTTAAA 0: 1
1: 0
2: 2
3: 60
4: 713
Right 1120772425 14:88395193-88395215 GTGGTATAGTTATCAAAACCAGG 0: 1
1: 0
2: 5
3: 31
4: 144
1120772420_1120772425 21 Left 1120772420 14:88395149-88395171 CCCTGTACTCTGCTCTTCCACTA 0: 1
1: 0
2: 1
3: 22
4: 226
Right 1120772425 14:88395193-88395215 GTGGTATAGTTATCAAAACCAGG 0: 1
1: 0
2: 5
3: 31
4: 144

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120772425 Original CRISPR GTGGTATAGTTATCAAAACC AGG Intronic
901346626 1:8550071-8550093 ATAGTACAGTTATCAGAACCAGG - Intronic
907538054 1:55183210-55183232 TTAGTATATTTATCAAAACCAGG - Intronic
911082232 1:93944542-93944564 GTTGTATAGTGATCAAATCAGGG + Intergenic
911113513 1:94218042-94218064 GTAATTTAGTTTTCAAAACCTGG - Intronic
911454402 1:98105093-98105115 GTGGTAAAACTATCAAAAACGGG - Intergenic
913181346 1:116325157-116325179 ATGGTACATTTATCAAAACTAGG - Intergenic
918157378 1:181862255-181862277 ATGGTACAGTTATCAAAATCAGG - Intergenic
919132093 1:193464337-193464359 GTGGTAGGGTTGTCAAAACTGGG + Intergenic
922427537 1:225513572-225513594 GTAATATAATTATCAAAATCAGG - Intronic
924514889 1:244757757-244757779 GTGGGAAAGTTCTGAAAACCTGG - Intergenic
1067809368 10:49415427-49415449 GCAGTACAGTTATCAAAACCAGG - Intergenic
1072105695 10:92271309-92271331 ATGGTATAATTATCAAAATCAGG + Intronic
1073109936 10:101056052-101056074 ATGATATAATTATCAAAACCAGG - Intergenic
1073519102 10:104109418-104109440 GTGGTATATTTAACAATATCAGG + Intergenic
1073768968 10:106714439-106714461 ATGGTATATTTTTCAAAACTAGG - Intronic
1075290198 10:121222827-121222849 GTGGTAAACTGACCAAAACCAGG - Intergenic
1076899782 10:133332770-133332792 CTGGTATCGTTATTAAAACAGGG + Intronic
1077426395 11:2480771-2480793 GTGGTACTGTTGTCAAAATCGGG - Intronic
1078189915 11:9085284-9085306 ATAGTACAATTATCAAAACCAGG - Intronic
1080099675 11:28445413-28445435 ATGGTATAGTTATGAAATTCAGG + Intergenic
1080468143 11:32517979-32518001 ATAGCACAGTTATCAAAACCAGG - Intergenic
1082740165 11:56902046-56902068 CTGTTATAGTTCTCATAACCTGG + Intergenic
1086096762 11:83058235-83058257 ACGGTATAATTATCAAAATCAGG + Intronic
1087859302 11:103133883-103133905 CCGGAGTAGTTATCAAAACCAGG + Intronic
1088579677 11:111302321-111302343 GTTATATAATTAACAAAACCAGG + Intronic
1090126448 11:124090283-124090305 ATAATATAGTTATCAAAACCAGG - Intergenic
1094659098 12:32449236-32449258 GTAATATAGCTATCAAAACCAGG + Intronic
1096380390 12:51152507-51152529 ATGGTATAATGATCAAAATCGGG - Intronic
1098144059 12:67480691-67480713 GTGGTACAGTTTTCTAAAACTGG - Intergenic
1101912309 12:108869285-108869307 GTGGTTTAGTGATTAAGACCAGG - Intronic
1102580749 12:113885572-113885594 ATAGTACAGTTATCAAAACCAGG - Intronic
1105362075 13:19729054-19729076 GTGGTGGAGTAATAAAAACCAGG + Intronic
1108319378 13:49273063-49273085 GTGGTATAATTTTGAAAACCAGG + Intronic
1108670061 13:52677338-52677360 GTGGTATAATTTTCAAAATCAGG + Intronic
1110345977 13:74448385-74448407 AAAGTATAGTTATCCAAACCAGG + Intergenic
1110514554 13:76394403-76394425 GTAGTATAGTTATCACATCAGGG + Intergenic
1115590657 14:34861519-34861541 GTGTTTTATTTAACAAAACCAGG - Intronic
1118664610 14:68054099-68054121 ATGATGTAATTATCAAAACCAGG + Intronic
1119460916 14:74802876-74802898 TTGGTGTACTTATCAAAATCTGG - Intronic
1120322053 14:82975927-82975949 CTGATGAAGTTATCAAAACCAGG - Intergenic
1120772425 14:88395193-88395215 GTGGTATAGTTATCAAAACCAGG + Intronic
1124485572 15:30112154-30112176 ATAGTATAGTTAGCAAAACCTGG + Intergenic
1124518004 15:30385113-30385135 ATAGTATAGTTAGCAAAACCTGG - Intronic
1124540649 15:30581140-30581162 ATAGTATAGTTAGCAAAACCTGG + Intergenic
1124758007 15:32426442-32426464 ATAGTATAGTTAGCAAAACCTGG - Intergenic
1127280834 15:57490967-57490989 CTGTTACAGTCATCAAAACCAGG + Intronic
1128808043 15:70548376-70548398 ATATTACAGTTATCAAAACCAGG - Intergenic
1129555823 15:76508144-76508166 GTGGTATAGATATGAAAAGAAGG - Intronic
1130005050 15:80088028-80088050 GTGATTAAGTTATCAAAATCAGG + Intronic
1130377794 15:83345397-83345419 GTGATATAGTTATTAAAATTAGG - Intergenic
1131245613 15:90789619-90789641 GGGGTACATTTATCAACACCAGG - Intronic
1143737088 17:8919229-8919251 ATGGTGCAGTTATCAAAACCAGG - Intronic
1144763344 17:17719902-17719924 GTGGAATAGATGTTAAAACCTGG + Intronic
1146564277 17:33898562-33898584 GTAGTACAATAATCAAAACCGGG + Intronic
1146577003 17:34003190-34003212 GTGGTCTTGATATCAAATCCTGG + Intronic
1146700519 17:34955357-34955379 GCAGTATAGTTATAAAAACCAGG - Intronic
1148377764 17:47164482-47164504 ATAGTACAGTTATCAAAACTAGG + Intronic
1149031639 17:52089793-52089815 GTGGTAAAGTTATAAAACCATGG + Intronic
1149741218 17:59047291-59047313 ATAGAATAGTTATCAAAATCTGG - Intronic
1150204579 17:63392934-63392956 GTAGTCTCATTATCAAAACCAGG + Intronic
1153256417 18:3176121-3176143 CTGTTATAGGTATAAAAACCAGG - Exonic
1157847886 18:51020316-51020338 ATGCTACAGTTATCAAAATCAGG + Intronic
1158141133 18:54257343-54257365 ATAGTATAATTATCAAAACCAGG + Intergenic
1159474200 18:68897949-68897971 GTGGTATAAATCTTAAAACCAGG + Intronic
926003751 2:9355114-9355136 TTTATGTAGTTATCAAAACCAGG + Intronic
927559759 2:24061653-24061675 ATAGTACAATTATCAAAACCAGG + Intronic
927736690 2:25530056-25530078 GTGATATAATTATGAAAAACAGG + Intronic
928288289 2:30012735-30012757 ATAGTATAATTATCAAAACCAGG - Intergenic
934959829 2:98662173-98662195 ATATTATAGTTATCAAAACCAGG - Intronic
935355157 2:102191304-102191326 ATAGTATAGTTATCAAATTCAGG + Intronic
936377631 2:111955638-111955660 ATGGTATAATGATCAAAACCAGG - Intronic
936841497 2:116774811-116774833 ATGATATAGTTATTAAAATCAGG + Intergenic
939504855 2:143032504-143032526 TTTTTATAGTTATCAAATCCAGG - Intronic
940267249 2:151851841-151851863 GTTGTCTAGCTATCAAAAGCCGG - Intronic
941410556 2:165151691-165151713 GTTGTATAGTTCACAAAACAGGG + Intronic
943569278 2:189554152-189554174 CAGGTATAGTTAACAAAACCTGG - Intergenic
944325872 2:198402996-198403018 TTGCTATAGTTGCCAAAACCAGG + Intronic
948583860 2:239006195-239006217 GTGGTATAATAATCAAATCAGGG + Intergenic
1169748926 20:8971835-8971857 ATGGTACAATAATCAAAACCAGG - Intergenic
1171500817 20:25591658-25591680 ATGGTGTAGTTATCGAAACCAGG + Intergenic
1172087744 20:32401096-32401118 ATAGTATAGTTATTAAAACTAGG + Intronic
1172796126 20:37539476-37539498 GTAGTATAATTATTAAAATCAGG - Intergenic
1174932435 20:54830436-54830458 GTGCTATAATTGTGAAAACCAGG + Intergenic
1177161775 21:17555483-17555505 ATATTATAATTATCAAAACCAGG + Intronic
1179202940 21:39243750-39243772 GTGATATAATTATCAAAATCAGG - Intronic
1179213501 21:39348104-39348126 GTGATATAGTTCTATAAACCAGG + Intronic
1183664289 22:39238440-39238462 GTGGTATTATTACCAAATCCGGG - Intronic
950879123 3:16307839-16307861 GTGGTATATTTATCAAAACTAGG + Intronic
952852120 3:37737993-37738015 GTAGTATAGTTATCACATTCAGG + Intronic
953313075 3:41899275-41899297 GTAGTATAGTTAGCAAAACCTGG - Intronic
953704883 3:45223721-45223743 GAGCTATAGTTCTCAAAGCCTGG - Intergenic
956996811 3:74835516-74835538 GTTGTATAGCTATCGAACCCTGG + Intergenic
957480456 3:80786443-80786465 ATAGTAAATTTATCAAAACCAGG + Intergenic
957522776 3:81341885-81341907 ATCGTACAGTTATCAAAACCGGG - Intergenic
958810309 3:98853258-98853280 GTGTTAAAGTTCTCAAAATCTGG + Intronic
959748788 3:109808867-109808889 GTGGTGTACTTATTAAAACATGG - Intergenic
960128773 3:114030063-114030085 ATAGTATAATTATCAAAACTAGG - Intronic
960280326 3:115774435-115774457 ATGGTATACTTATCAAAACCAGG + Intergenic
960976706 3:123182411-123182433 ACAGTACAGTTATCAAAACCTGG - Intronic
961073338 3:123958677-123958699 ACAGTATAATTATCAAAACCAGG + Intronic
961310305 3:125994067-125994089 ACAGTATAATTATCAAAACCAGG - Intergenic
961966075 3:130904212-130904234 ATAGTATAATTATTAAAACCAGG + Intronic
961981676 3:131085770-131085792 ATAGTATAATTATCAAAACTAGG + Intronic
964756333 3:160093320-160093342 GTGGCTTGGTTATTAAAACCAGG - Intergenic
965842666 3:172925221-172925243 GTGGGTTAGTTAACAATACCTGG - Intronic
972461733 4:39310392-39310414 ATAGCATAGTTATAAAAACCAGG - Intronic
972483684 4:39522724-39522746 GTGGTATAGATATCAACTCATGG + Intronic
972666554 4:41170752-41170774 ATTGTACAGTTACCAAAACCAGG - Intronic
974310468 4:60201721-60201743 CTTGTTTAGTCATCAAAACCTGG + Intergenic
975953860 4:79811407-79811429 ATAGTACAATTATCAAAACCAGG - Intergenic
976749492 4:88439718-88439740 GTTGTATTGTGACCAAAACCTGG - Intronic
976777085 4:88718855-88718877 GTGGTATAGTTATCAAACCAAGG + Intergenic
978505149 4:109448747-109448769 TTGGTACATTTATCAAAACCAGG + Intronic
978773791 4:112485575-112485597 ATTGTATATTTCTCAAAACCTGG - Intergenic
979656455 4:123199895-123199917 GTGGAATATTTACCTAAACCAGG + Intronic
980156012 4:129107193-129107215 GTGGTTTAGTTTTTAAACCCTGG - Intronic
980427188 4:132641127-132641149 GATGTATAATTATCAAATCCAGG - Intergenic
980756887 4:137176528-137176550 ATAGTACAATTATCAAAACCAGG - Intergenic
983095125 4:163552408-163552430 GTGGTATCTTTACCCAAACCTGG - Intronic
984261450 4:177447527-177447549 GTGATATAGTTTTCATAACAAGG + Intergenic
986008622 5:3690713-3690735 ATAGTATAATTATCAAAATCGGG + Intergenic
988559104 5:32264227-32264249 GTGGTATATGTATAAATACCCGG - Intronic
990242134 5:53826433-53826455 GTGGCACATTTAGCAAAACCAGG + Intergenic
992981518 5:82179143-82179165 GTTGTATAGGTATCAAAATATGG + Intronic
994308953 5:98243641-98243663 TTGGAATAATTATCAAAACCAGG - Intergenic
997277058 5:132602682-132602704 ATAATACAGTTATCAAAACCAGG + Intronic
998798008 5:145839329-145839351 GGGATATAGTTATTGAAACCAGG + Intergenic
999464673 5:151791302-151791324 GTAGTACAGTTATCAAATTCAGG + Intronic
999884669 5:155908614-155908636 GAGGTACAGTTGTCAAACCCTGG + Intronic
1000309102 5:160024343-160024365 ATAGTGCAGTTATCAAAACCAGG + Intronic
1003293885 6:4806545-4806567 GTAGCACAGTTACCAAAACCGGG + Intronic
1005308945 6:24540848-24540870 GTAATACAATTATCAAAACCAGG + Intergenic
1007643915 6:43366068-43366090 GTGCTATAGTCATTAAAACATGG + Intronic
1007737142 6:43988571-43988593 GTGGTAGAGTGATAAAAATCTGG + Intergenic
1011566590 6:88680282-88680304 GTGGTATAATAATAATAACCAGG + Intronic
1012289570 6:97436238-97436260 TAGACATAGTTATCAAAACCAGG - Intergenic
1015404143 6:132818410-132818432 TTGGTATAGTCTTCAAAACCAGG - Intergenic
1015504682 6:133970879-133970901 GTTGTATAGTGATCAAATCAGGG + Intronic
1016102948 6:140126041-140126063 ATGGTACATTTGTCAAAACCAGG + Intergenic
1016846013 6:148569374-148569396 GTGGTACAGTTCTGAGAACCAGG + Intergenic
1019277991 7:186034-186056 GTGGTATAATGAACAAAAGCTGG - Intergenic
1020845765 7:13280773-13280795 GTAGTATAGCGAGCAAAACCTGG + Intergenic
1023141300 7:37105034-37105056 ATGGTATAGTAATTAAAGCCTGG + Intronic
1024864536 7:53889661-53889683 GTGATATAATTATCAAAGCCAGG - Intergenic
1024943264 7:54783735-54783757 GTAGTATAATCATCAAAGCCAGG + Intergenic
1031847325 7:126821751-126821773 ATGGTACAATTATCAAAACTAGG + Intronic
1034281018 7:149854476-149854498 GAGTTATAATGATCAAAACCAGG - Intronic
1035002961 7:155630494-155630516 GTGGTATAATTGTAAAAACTAGG + Intronic
1038002870 8:23405304-23405326 GGGGTGTAGTTATCAAAGGCAGG + Intronic
1039514601 8:38121489-38121511 ATAGTACAGTTATCAAAACTGGG + Intronic
1039672751 8:39621376-39621398 GTCATAAACTTATCAAAACCAGG - Intronic
1040848897 8:51877847-51877869 GCAGTATAGTTATTAAAATCAGG - Intronic
1041185722 8:55298935-55298957 GTCGTGTAGTTATCAAACTCAGG + Intronic
1041625908 8:60026449-60026471 ATGGTACAGTTGTCAAAACTAGG + Intergenic
1042469482 8:69168009-69168031 CAGGTATAGTAATTAAAACCAGG + Intergenic
1044474494 8:92609960-92609982 ATGGTATGGTTTTAAAAACCTGG - Intergenic
1045149299 8:99385720-99385742 GAGGAATAGTTCTCACAACCAGG + Intronic
1048108276 8:131437168-131437190 GTGGTGTAATTATCAAATCATGG - Intergenic
1050484653 9:6121424-6121446 GTGTTATAGTTATAAAAAAATGG - Intergenic
1050551477 9:6752389-6752411 TTGGTAACGTTCTCAAAACCAGG + Intronic
1050951704 9:11604427-11604449 GTAGTACAATTAGCAAAACCAGG - Intergenic
1051453707 9:17228176-17228198 GTGCTATGGTTATCCAAAGCTGG - Intronic
1055383139 9:75730935-75730957 ATAGTACAGTTATCAAAAACTGG + Intergenic
1057365148 9:94413308-94413330 ATGGTATAATTATCTAAACCAGG - Intronic
1057512105 9:95689237-95689259 AGAGTACAGTTATCAAAACCAGG + Intergenic
1057658177 9:96974782-96974804 ATGGCATAATTATCTAAACCAGG + Intronic
1059189604 9:112312031-112312053 GTGATACAGTTAACAAAATCAGG - Intronic
1186655516 X:11608059-11608081 GTGGGAGAGTAATGAAAACCAGG - Intronic
1186992618 X:15085672-15085694 ATGGTACAGTTATCAAAACCAGG - Intergenic
1187180952 X:16943347-16943369 GAGCAATAGTTATCAGAACCTGG - Intergenic
1188257072 X:27976142-27976164 ATAGTATAATTATCAAGACCAGG - Intergenic
1188891633 X:35618489-35618511 GTTGTATAATGATCAAAATCAGG - Intergenic
1189909984 X:45801041-45801063 GTGGTATACTTATCAAGGCCAGG - Intergenic
1190825256 X:54012056-54012078 TTTGTATAGTTATCAAAATCAGG - Intronic
1194204706 X:90998145-90998167 ATGCTAGAATTATCAAAACCTGG + Intergenic
1195261707 X:103138553-103138575 GGGAAATAGTTATCAAAACATGG - Intergenic
1195631594 X:107061239-107061261 ATAGTACAGTTATCAAAATCAGG - Intergenic
1196261685 X:113590069-113590091 TTAGTATAATTATCAAAATCAGG + Intergenic
1198000946 X:132434918-132434940 ATTGCACAGTTATCAAAACCAGG - Intronic
1200550549 Y:4573603-4573625 ATGCTAGAATTATCAAAACCTGG + Intergenic
1201935211 Y:19404348-19404370 ATGATATAGTTATAAAAACAAGG + Intergenic