ID: 1120778627

View in Genome Browser
Species Human (GRCh38)
Location 14:88464987-88465009
Sequence CAGAAACAGGAGGAGGAGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2027
Summary {0: 1, 1: 1, 2: 22, 3: 231, 4: 1772}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120778627_1120778635 8 Left 1120778627 14:88464987-88465009 CCTCCCTCCTCCTCCTGTTTCTG 0: 1
1: 1
2: 22
3: 231
4: 1772
Right 1120778635 14:88465018-88465040 TTGCTTTCTGGACGTTTCTAAGG 0: 1
1: 0
2: 0
3: 15
4: 184
1120778627_1120778636 17 Left 1120778627 14:88464987-88465009 CCTCCCTCCTCCTCCTGTTTCTG 0: 1
1: 1
2: 22
3: 231
4: 1772
Right 1120778636 14:88465027-88465049 GGACGTTTCTAAGGAAGCACAGG 0: 1
1: 0
2: 1
3: 7
4: 82
1120778627_1120778634 -4 Left 1120778627 14:88464987-88465009 CCTCCCTCCTCCTCCTGTTTCTG 0: 1
1: 1
2: 22
3: 231
4: 1772
Right 1120778634 14:88465006-88465028 TCTGGCTAGACATTGCTTTCTGG 0: 1
1: 0
2: 1
3: 7
4: 148

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120778627 Original CRISPR CAGAAACAGGAGGAGGAGGG AGG (reversed) Intronic
Too many off-targets to display for this crispr