ID: 1120778634

View in Genome Browser
Species Human (GRCh38)
Location 14:88465006-88465028
Sequence TCTGGCTAGACATTGCTTTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 157
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 148}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120778627_1120778634 -4 Left 1120778627 14:88464987-88465009 CCTCCCTCCTCCTCCTGTTTCTG 0: 1
1: 1
2: 22
3: 231
4: 1772
Right 1120778634 14:88465006-88465028 TCTGGCTAGACATTGCTTTCTGG 0: 1
1: 0
2: 1
3: 7
4: 148
1120778623_1120778634 23 Left 1120778623 14:88464960-88464982 CCACTCAGTCCCACAACACCACA 0: 1
1: 0
2: 0
3: 13
4: 266
Right 1120778634 14:88465006-88465028 TCTGGCTAGACATTGCTTTCTGG 0: 1
1: 0
2: 1
3: 7
4: 148
1120778625_1120778634 13 Left 1120778625 14:88464970-88464992 CCACAACACCACACTCTCCTCCC 0: 1
1: 0
2: 6
3: 61
4: 730
Right 1120778634 14:88465006-88465028 TCTGGCTAGACATTGCTTTCTGG 0: 1
1: 0
2: 1
3: 7
4: 148
1120778629_1120778634 -7 Left 1120778629 14:88464990-88465012 CCCTCCTCCTCCTGTTTCTGGCT 0: 1
1: 1
2: 9
3: 121
4: 878
Right 1120778634 14:88465006-88465028 TCTGGCTAGACATTGCTTTCTGG 0: 1
1: 0
2: 1
3: 7
4: 148
1120778626_1120778634 5 Left 1120778626 14:88464978-88465000 CCACACTCTCCTCCCTCCTCCTC 0: 1
1: 7
2: 62
3: 676
4: 4636
Right 1120778634 14:88465006-88465028 TCTGGCTAGACATTGCTTTCTGG 0: 1
1: 0
2: 1
3: 7
4: 148
1120778624_1120778634 14 Left 1120778624 14:88464969-88464991 CCCACAACACCACACTCTCCTCC 0: 1
1: 0
2: 0
3: 64
4: 765
Right 1120778634 14:88465006-88465028 TCTGGCTAGACATTGCTTTCTGG 0: 1
1: 0
2: 1
3: 7
4: 148
1120778630_1120778634 -8 Left 1120778630 14:88464991-88465013 CCTCCTCCTCCTGTTTCTGGCTA 0: 1
1: 0
2: 2
3: 60
4: 636
Right 1120778634 14:88465006-88465028 TCTGGCTAGACATTGCTTTCTGG 0: 1
1: 0
2: 1
3: 7
4: 148

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120778634 Original CRISPR TCTGGCTAGACATTGCTTTC TGG Intronic
900947054 1:5836979-5837001 TGGGGCTAGACTTAGCTTTCCGG - Intergenic
901429551 1:9204784-9204806 TCTAGCGGGACATTTCTTTCTGG + Intergenic
903325039 1:22564479-22564501 TCTGACAAGACTTTGCTCTCCGG - Intronic
903776544 1:25797706-25797728 TCTGGCCAGACCTTGACTTCAGG - Intergenic
904422000 1:30400075-30400097 TCTGACTGGACATTACTTCCAGG - Intergenic
905868794 1:41391351-41391373 TCTGCCTAGACCCTGCTTTGAGG - Intergenic
907473356 1:54689063-54689085 TCTGGGCAGACATGTCTTTCGGG - Intronic
907619550 1:55962541-55962563 TCTGCCCAGACATTGACTTCGGG - Intergenic
908359122 1:63350259-63350281 TCTGGTTAAAAATTGTTTTCAGG - Intergenic
908960605 1:69692793-69692815 TCTGGCTAAACATTATTTCCAGG + Intronic
911254877 1:95621648-95621670 TCTGGTTAGAGTTTGCTTTCTGG - Intergenic
911524371 1:98966113-98966135 TCTAGCCAGGCATTGTTTTCTGG - Intronic
911998662 1:104800653-104800675 CCTGTCCAGACATTGCCTTCAGG + Intergenic
912538473 1:110394654-110394676 TTTGGCTAGACATTATTTTGGGG - Intergenic
913280990 1:117184918-117184940 ACTGGCTGGGCATTGCTTCCAGG - Intronic
913317943 1:117568055-117568077 TCTGGCTAGACAAAACTTTTTGG - Intergenic
917597088 1:176539846-176539868 TGTGGCCATGCATTGCTTTCAGG + Intronic
1063421498 10:5916053-5916075 TCTGACTGGAAATGGCTTTCAGG - Intronic
1063691591 10:8292807-8292829 TCTGGCTGGACAGGCCTTTCTGG - Intergenic
1065600181 10:27359793-27359815 TCTGGCTTGACAAAACTTTCTGG + Intergenic
1066135406 10:32440787-32440809 ACTGACAAGACATGGCTTTCTGG + Intergenic
1067823263 10:49549557-49549579 TCTGGATTGACATCCCTTTCTGG - Intergenic
1069313057 10:67063203-67063225 TCTTACTAGGCATTGCTTTAAGG - Intronic
1070529449 10:77323921-77323943 TCTGTCTAGAAATTGCCTCCAGG - Intronic
1073413945 10:103365893-103365915 CCTGGCTTGACCTTGCTTACTGG - Intergenic
1074353919 10:112764597-112764619 TCTGTCTAGACATTTTTCTCTGG + Intronic
1077904442 11:6518959-6518981 TCTGGCCAAGCATAGCTTTCTGG + Intronic
1078570809 11:12456518-12456540 TGTGGCTCCCCATTGCTTTCAGG + Intronic
1082776711 11:57250831-57250853 GCTGGCTAAACATCTCTTTCAGG - Intergenic
1083069592 11:59963384-59963406 TTTGGCAAAACAATGCTTTCTGG - Intergenic
1086471952 11:87123240-87123262 TCTGCCAACACCTTGCTTTCAGG - Intronic
1087962493 11:104369109-104369131 TCTGGAGAGAGCTTGCTTTCTGG - Intergenic
1097745521 12:63298211-63298233 TCTAGCTATACATTTCTCTCAGG + Intergenic
1099422931 12:82485609-82485631 TCTGGCTTGACAGTGCCATCTGG + Intergenic
1100252405 12:92841018-92841040 TCTGGTGAAACATTGCTTTCTGG - Intronic
1100574696 12:95879592-95879614 TCTGGTTAGAAATTGCTTAATGG + Intronic
1101419809 12:104541331-104541353 TCTGGCTTGACATCCCTTTTGGG + Intronic
1102030856 12:109739348-109739370 TCTGGCTAGATGTTCCTTTCTGG + Intronic
1102417811 12:112779733-112779755 TCTGGGTAGACATGGATTTTAGG - Intronic
1104471948 12:129036465-129036487 TCTGGGTGGACATGACTTTCGGG - Intergenic
1106303694 13:28492692-28492714 TCTTACTAGACATTGCTTCCCGG + Intronic
1106651493 13:31695042-31695064 TCTGACTAGACTTTGCAGTCAGG - Intergenic
1106654805 13:31731940-31731962 GCTGGCTAGACATTGCTGTCTGG + Intergenic
1107881626 13:44837109-44837131 TCTGGGAAGAAATTGCTTTCTGG + Intergenic
1110861422 13:80348500-80348522 CCTGGCTTCACATTACTTTCTGG + Intergenic
1111098456 13:83546575-83546597 TTTGGCTAGTCATTGGTTACTGG + Intergenic
1113065931 13:106374398-106374420 TCTGGCTGGATTTTGGTTTCTGG + Intergenic
1113318060 13:109205105-109205127 TATGTCTAGAAATTGCTTTAGGG + Intronic
1114673309 14:24425284-24425306 TCTGGCTGGACATGGCTGCCTGG + Intergenic
1115504562 14:34080773-34080795 TCTAGGTAGACAATTCTTTCAGG + Intronic
1116909528 14:50444984-50445006 TATGGCTAGATATTGTTATCTGG - Intronic
1117525666 14:56600522-56600544 TCTGAATAGACATTTCTTTAAGG + Intronic
1117809574 14:59532561-59532583 TCTGGCTAGAGTGTGGTTTCTGG + Intronic
1119206759 14:72800215-72800237 CCTGGCTAGAATTTCCTTTCAGG - Intronic
1120304743 14:82754870-82754892 TCTGACTAGACATTGCTCAAAGG + Intergenic
1120778634 14:88465006-88465028 TCTGGCTAGACATTGCTTTCTGG + Intronic
1121619350 14:95335448-95335470 TGTGGCCACACATGGCTTTCAGG - Intergenic
1126679532 15:51189992-51190014 TCTGGCTGGACAGTGCTGCCTGG + Intergenic
1131424958 15:92338311-92338333 ACTGGTGAGACATTGCATTCGGG + Intergenic
1131607350 15:93921077-93921099 TCTGGTTAGACATTACTTCGGGG - Intergenic
1133581616 16:7149785-7149807 TGTGGCTAGACATTACTTAATGG - Intronic
1135841122 16:25877212-25877234 TCTGGGTAGACATGAATTTCAGG - Intronic
1136843596 16:33558539-33558561 CCTGGCCAGACCTGGCTTTCAGG + Intergenic
1138941778 16:61800278-61800300 TGTGGGTAGACATTGCGTTTAGG - Intronic
1203148755 16_KI270728v1_random:1820651-1820673 CCTGGCCAGACCTGGCTTTCAGG + Intergenic
1203153761 16_KI270728v1_random:1858837-1858859 CCTGGCCAGACCTGGCTTTCAGG + Intergenic
1143976132 17:10831302-10831324 TCTGGGTAGACATATCTTTTGGG - Intronic
1148328617 17:46799151-46799173 TCTGGCATGACCTTGCGTTCTGG - Intronic
1151069510 17:71192570-71192592 TGTGGCAAGACAATGCTATCAGG + Intergenic
1158983690 18:62791317-62791339 TGTGGCTACACAGTGCTGTCAGG - Intronic
1167824725 19:51961851-51961873 TCTTGCTAGACACTGTTTTAAGG + Intergenic
926730721 2:16033844-16033866 TCTTGGTACACATTGCTTCCTGG + Intergenic
930005691 2:46894666-46894688 TCTGGATTGACAGTTCTTTCAGG + Intergenic
937847042 2:126590971-126590993 TTTGGCTAGACATGGAATTCTGG - Intergenic
939576848 2:143905923-143905945 TCTGGAAACACATTTCTTTCTGG + Intergenic
940100879 2:150036961-150036983 TCTTGCTTGGCATTTCTTTCAGG - Intergenic
944496172 2:200308340-200308362 TCTAACAACACATTGCTTTCTGG - Intronic
946112186 2:217429691-217429713 TCTGGCAACACCTTGCTTTAAGG + Intronic
946231750 2:218295696-218295718 TCTGGCTCCCCATTGCTTTCAGG - Intronic
946701568 2:222419795-222419817 TCTGGTTAGACTTTCTTTTCTGG + Intergenic
1169205033 20:3734577-3734599 TCTGCCCAGACCTAGCTTTCGGG + Intronic
1170187607 20:13608729-13608751 TCTGGCCAGATTTGGCTTTCTGG + Intronic
1170273146 20:14550520-14550542 TCTGGTGAGAGACTGCTTTCTGG - Intronic
1172822694 20:37751806-37751828 TCTTGTTAGACAGTGCTTACGGG - Intronic
1175663214 20:60835709-60835731 TCTGGGTAGGCATGGCTGTCAGG - Intergenic
1176694826 21:9962684-9962706 TTTGTCTAGACATTGACTTCAGG - Intergenic
1177195765 21:17901897-17901919 TCTTGCTACTCATTGCTTTCAGG + Intronic
1177800008 21:25819472-25819494 TCTGGCTAGACATGAATTTTGGG - Intergenic
1180800492 22:18629639-18629661 CCAGGCTAGACATTCCTTGCAGG + Intergenic
1180851727 22:19025196-19025218 CCAGGCTAGACATTCCTTGCAGG + Intergenic
1181221227 22:21365623-21365645 CCAGGCTAGACATTCCTTGCAGG - Intergenic
1181776381 22:25162704-25162726 GCCGGCTAGATTTTGCTTTCAGG - Intronic
1181830257 22:25554960-25554982 TCTGGCTTCTCATTGCTCTCAGG + Intergenic
1185233717 22:49699182-49699204 TCCGGCAAGACATTGCTTAGGGG + Intergenic
956709815 3:72029413-72029435 TTTTGAAAGACATTGCTTTCAGG + Intergenic
962224967 3:133598252-133598274 TCTGGTGAGACATTTCTTCCTGG + Intronic
967669010 3:192210156-192210178 GCTGTCTAGACATTTCCTTCTGG - Intronic
971210716 4:24613305-24613327 TCTGGTGAGAGCTTGCTTTCCGG - Intergenic
975079581 4:70260112-70260134 TTTAGCTAGAAATTGCTTTTTGG - Intergenic
975592289 4:76011908-76011930 TATGGCTAGACAAGGCTTTTAGG + Intronic
975870255 4:78772575-78772597 TCTGCCTAAAAATTGATTTCAGG + Intergenic
976376290 4:84349454-84349476 TCTGGTTACAGACTGCTTTCTGG + Intergenic
976817441 4:89165510-89165532 TCTGGCTATTCATCACTTTCAGG + Intergenic
977273528 4:94947791-94947813 TCAGGAGAGACATTCCTTTCAGG - Intronic
980367453 4:131822905-131822927 TTTGTCTAGACATTGACTTCGGG - Intergenic
981404993 4:144357515-144357537 TCTGGCTAGACTTTACTTGGAGG - Intergenic
983669384 4:170217702-170217724 TCTGCCCTGCCATTGCTTTCTGG - Intergenic
984489031 4:180408882-180408904 TCTGAGAAGACCTTGCTTTCTGG - Intergenic
985294747 4:188423982-188424004 TCTGGCTACAAAGAGCTTTCAGG - Intergenic
986575913 5:9213005-9213027 TCTGGCAAGGGTTTGCTTTCTGG + Intronic
987706697 5:21468384-21468406 TCTGGCTGGACAGGCCTTTCTGG + Intergenic
989283494 5:39672180-39672202 TCTTTATAGACATTGATTTCTGG + Intergenic
989686990 5:44100974-44100996 TATGGCTTGACATTGCCTTATGG - Intergenic
993733201 5:91446502-91446524 TGTGGCTAGAGATTGTTTTTAGG - Intergenic
995056495 5:107765190-107765212 TCTTCCTACACATTGCTTTGTGG - Intergenic
995839636 5:116431077-116431099 TCTGGGTAGACATGACATTCGGG - Intergenic
996959070 5:129222364-129222386 TCGGACTACATATTGCTTTCCGG + Intergenic
1001440292 5:171737694-171737716 TCTGGCAAGCCCTTGGTTTCTGG - Intergenic
1003655066 6:7999512-7999534 AATGTTTAGACATTGCTTTCTGG - Intronic
1008705685 6:54156071-54156093 TCTGACCAGAGATTGCTTTTTGG - Intronic
1008804888 6:55414986-55415008 AGTGGCTAGTCAGTGCTTTCAGG + Intergenic
1009766375 6:68081280-68081302 TATGTCTAGACATTAATTTCAGG + Intergenic
1012797964 6:103787864-103787886 TTTGGCTACACATCTCTTTCTGG - Intergenic
1012991080 6:105926667-105926689 TCTTGCTTTAAATTGCTTTCAGG - Intergenic
1015262494 6:131254350-131254372 TCATGATAGACATTCCTTTCAGG - Intronic
1016150164 6:140730633-140730655 GCTTGTTAGACATTGCCTTCTGG - Intergenic
1016417668 6:143850034-143850056 TCTGGATGGACATTGATTTGGGG + Intronic
1029129548 7:98319489-98319511 TCTGTGAAGACAATGCTTTCTGG + Intronic
1029178635 7:98683514-98683536 TCTGGCGAGAATCTGCTTTCTGG - Intergenic
1030072446 7:105709653-105709675 TCTGCCTAGCCAATTCTTTCTGG + Intronic
1031047534 7:116909213-116909235 TTTTGCTAGACAATGATTTCTGG - Intronic
1037223047 8:16548863-16548885 TCTGGCTATAGATTGATATCTGG + Intronic
1038263830 8:26021147-26021169 TCTGTCTAGACCCTGCTTTATGG - Intronic
1038809308 8:30823613-30823635 TCTGGCTTCACGTTGCTATCAGG - Intergenic
1043682614 8:83048691-83048713 AATGGCTAGACATTCCCTTCAGG - Intergenic
1045625663 8:104046182-104046204 TCTGGCTAGGGCCTGCTTTCTGG + Intronic
1050029984 9:1375757-1375779 TCTGGATAGAGATGCCTTTCTGG - Intergenic
1052723674 9:32203299-32203321 TCTGGATATACATAGCTTCCTGG + Intergenic
1053631797 9:39948625-39948647 TTTGTCTAGACATTGACTTCAGG - Intergenic
1053773964 9:41514904-41514926 TTTGTCTAGACATTGACTTCAGG + Intergenic
1054212090 9:62302073-62302095 TTTGTCTAGACATTGACTTCAGG + Intergenic
1054312894 9:63546757-63546779 TTTGTCTAGACATTGACTTCAGG - Intergenic
1055760439 9:79601321-79601343 TCTGGATAGATATTCCTTTATGG + Intronic
1059009432 9:110440734-110440756 TCACGCTAGACAATTCTTTCTGG - Intronic
1185846708 X:3444055-3444077 TCTGGCCAGAGATAGGTTTCAGG - Intergenic
1187500423 X:19834023-19834045 TGCTGCTAAACATTGCTTTCTGG - Intronic
1193995329 X:88360026-88360048 TCTGAATAGACATTTCTTTAAGG + Intergenic
1194874493 X:99169881-99169903 TGTTGCTGGACTTTGCTTTCAGG - Intergenic
1196733085 X:118960889-118960911 TCTGAATAGACATTTCTTTGGGG + Intergenic
1197849621 X:130843757-130843779 GGTGGCTAGAGATAGCTTTCTGG - Intronic
1199505522 X:148556980-148557002 TCTTGCTCCAAATTGCTTTCTGG - Intronic
1199804349 X:151282919-151282941 TCTGGCTTGACATTGAAGTCTGG - Intergenic
1202331117 Y:23754036-23754058 TCTGGACAGTCAGTGCTTTCTGG + Intergenic
1202348581 Y:23962175-23962197 TCTGGGCAGTCAGTGCTTTCTGG + Intergenic
1202522193 Y:25707929-25707951 TCTGGGCAGTCAGTGCTTTCTGG - Intergenic
1202539652 Y:25916024-25916046 TCTGGACAGTCAGTGCTTTCTGG - Intergenic
1202623910 Y:56838160-56838182 CCTGTCTAGGCATTGCTTACAGG + Intergenic