ID: 1120778636

View in Genome Browser
Species Human (GRCh38)
Location 14:88465027-88465049
Sequence GGACGTTTCTAAGGAAGCAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 91
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 82}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120778633_1120778636 4 Left 1120778633 14:88465000-88465022 CCTGTTTCTGGCTAGACATTGCT 0: 1
1: 0
2: 0
3: 9
4: 117
Right 1120778636 14:88465027-88465049 GGACGTTTCTAAGGAAGCACAGG 0: 1
1: 0
2: 1
3: 7
4: 82
1120778630_1120778636 13 Left 1120778630 14:88464991-88465013 CCTCCTCCTCCTGTTTCTGGCTA 0: 1
1: 0
2: 2
3: 60
4: 636
Right 1120778636 14:88465027-88465049 GGACGTTTCTAAGGAAGCACAGG 0: 1
1: 0
2: 1
3: 7
4: 82
1120778627_1120778636 17 Left 1120778627 14:88464987-88465009 CCTCCCTCCTCCTCCTGTTTCTG 0: 1
1: 1
2: 22
3: 231
4: 1772
Right 1120778636 14:88465027-88465049 GGACGTTTCTAAGGAAGCACAGG 0: 1
1: 0
2: 1
3: 7
4: 82
1120778632_1120778636 7 Left 1120778632 14:88464997-88465019 CCTCCTGTTTCTGGCTAGACATT 0: 1
1: 0
2: 0
3: 16
4: 166
Right 1120778636 14:88465027-88465049 GGACGTTTCTAAGGAAGCACAGG 0: 1
1: 0
2: 1
3: 7
4: 82
1120778631_1120778636 10 Left 1120778631 14:88464994-88465016 CCTCCTCCTGTTTCTGGCTAGAC 0: 1
1: 0
2: 0
3: 14
4: 169
Right 1120778636 14:88465027-88465049 GGACGTTTCTAAGGAAGCACAGG 0: 1
1: 0
2: 1
3: 7
4: 82
1120778626_1120778636 26 Left 1120778626 14:88464978-88465000 CCACACTCTCCTCCCTCCTCCTC 0: 1
1: 7
2: 62
3: 676
4: 4636
Right 1120778636 14:88465027-88465049 GGACGTTTCTAAGGAAGCACAGG 0: 1
1: 0
2: 1
3: 7
4: 82
1120778629_1120778636 14 Left 1120778629 14:88464990-88465012 CCCTCCTCCTCCTGTTTCTGGCT 0: 1
1: 1
2: 9
3: 121
4: 878
Right 1120778636 14:88465027-88465049 GGACGTTTCTAAGGAAGCACAGG 0: 1
1: 0
2: 1
3: 7
4: 82

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120778636 Original CRISPR GGACGTTTCTAAGGAAGCAC AGG Intronic
903452826 1:23466184-23466206 GGACATTTCTAAGGAAGAACAGG + Intronic
908134577 1:61117350-61117372 GAATGTTTCTAATGAATCACTGG + Intronic
915001478 1:152597722-152597744 GGAAGTTTCAAGGGGAGCACTGG + Intronic
916092248 1:161316488-161316510 GCACATGTCTAAGGGAGCACAGG + Intronic
917177261 1:172249697-172249719 AGACATTTTGAAGGAAGCACTGG - Intronic
919780452 1:201217480-201217502 GGAGGGGTCTAAGGAAGCTCTGG - Intronic
920209178 1:204315632-204315654 GGACATTTCTAGGGAATGACTGG - Intronic
1063665374 10:8057673-8057695 GGCCGTTTCTGAGCAAGCACTGG + Intronic
1064967430 10:21029502-21029524 GGACGTTGCTGATCAAGCACAGG + Intronic
1070025123 10:72625185-72625207 GGGCGTTTCTAAGGTACCACAGG + Intronic
1072031698 10:91528102-91528124 GCACATTTCTAAGGAGGAACTGG - Intergenic
1073009156 10:100346758-100346780 GGAAGTTTCTCAGGAAACAGTGG - Intergenic
1075367274 10:121903312-121903334 GGACATTTCTCTGAAAGCACTGG + Intronic
1076259260 10:129052732-129052754 GGGAGTTTCTCAGGATGCACGGG - Intergenic
1077866556 11:6226350-6226372 GCACTGTTCTAAGTAAGCACTGG + Intronic
1078645965 11:13141655-13141677 GGGCGCCTCTAAGGAAGCACAGG - Intergenic
1079853159 11:25564331-25564353 GGGCATTTAAAAGGAAGCACTGG - Intergenic
1082006961 11:47424754-47424776 GGAACTGTCTTAGGAAGCACTGG - Intronic
1083161185 11:60855121-60855143 TGACCATTCTCAGGAAGCACAGG - Intronic
1093876736 12:24357467-24357489 GGAGGTTCCAACGGAAGCACAGG + Intergenic
1096644321 12:53021832-53021854 GGACGTTGCTGATCAAGCACAGG + Exonic
1101022889 12:100571965-100571987 GGATGATTATAAGGAAGGACTGG - Intergenic
1102050599 12:109858867-109858889 GGATGTTACTAAGGCAGCATGGG + Intronic
1106931295 13:34668582-34668604 GGAAGTTACGAAGGAACCACAGG - Intergenic
1107664485 13:42674823-42674845 GCACATTTCAAAGGAAGGACTGG - Intergenic
1111795046 13:92908769-92908791 GCACTTTTCTAAGGAATCGCTGG + Intergenic
1113140282 13:107140197-107140219 AAACTTTTCTAAAGAAGCACAGG - Intergenic
1114187559 14:20414316-20414338 AGAGGTTTCTAAGGAAGGAAAGG - Intergenic
1116751995 14:48898456-48898478 TGATGTTTCTAAGGAAGTACAGG - Intergenic
1117301554 14:54434255-54434277 GGACGTTTTTATAGCAGCACAGG - Intronic
1120778636 14:88465027-88465049 GGACGTTTCTAAGGAAGCACAGG + Intronic
1124159807 15:27258051-27258073 GGGCGTTTCCAAGGAAGCTGTGG - Intronic
1128320654 15:66691641-66691663 GGACTTATCCCAGGAAGCACTGG - Intergenic
1128670643 15:69572445-69572467 GTCCTTTTCTTAGGAAGCACCGG + Intergenic
1129325072 15:74795564-74795586 GGACCTGTCTCAGGAAGCAGAGG - Intronic
1137337671 16:47566371-47566393 GGACGTTGCTGATCAAGCACAGG - Intronic
1140820476 16:78658423-78658445 GCACGTTTTCAAGGAAGCCCTGG - Intronic
1141974207 16:87503931-87503953 GGAGGTTCCTGAGGAAGCAGAGG + Intergenic
1143267802 17:5653494-5653516 GGAGGTTTCTAGAAAAGCACAGG + Intergenic
1143783073 17:9239623-9239645 GGACGGCTGCAAGGAAGCACAGG - Exonic
1149767405 17:59290757-59290779 GCACGTGTTTCAGGAAGCACAGG + Intergenic
1152896056 17:82912048-82912070 GGAAATTTCTCAGGAAGCAGAGG + Intronic
1153682599 18:7514634-7514656 GGAGGTGTCGAAGGAAGCAGGGG + Intergenic
1155233733 18:23798378-23798400 GGACTTTTCTAAAGAAAGACCGG - Intronic
1157844982 18:50994767-50994789 AGACTTTTCTAAGGATACACAGG + Intronic
1160330027 18:77982950-77982972 AGACGTTTGTAAGGAAGGGCAGG + Intergenic
1167049525 19:47069906-47069928 GGGGGTGTCTCAGGAAGCACGGG + Intronic
925842924 2:8009344-8009366 GGACGTTTCGGTGGAATCACAGG - Intergenic
929525923 2:42702876-42702898 GCACGTTTCTAAGGAATTAATGG + Intronic
930362496 2:50399521-50399543 GAGCTTTTATAAGGAAGCACAGG + Intronic
941188454 2:162345365-162345387 GGACGTTTTTAAAGACCCACAGG - Intronic
942851770 2:180495480-180495502 GGACTTTTCCAAGGGTGCACAGG + Intergenic
944482085 2:200167975-200167997 GGCAGTTACTAAGGAAGCAATGG - Intergenic
945846122 2:214947163-214947185 GTGCGTTTCCAAGGAAACACTGG - Intronic
947731366 2:232433333-232433355 GGACGTTTCCATGAAACCACAGG - Intergenic
1175197211 20:57252475-57252497 GGACGTTCCTCAGGAAGAATAGG - Intronic
1179312509 21:40209215-40209237 GGAGGTTGTTAAGGAAGCAGTGG + Intronic
950031133 3:9854436-9854458 GCACGTGTCTCAGGGAGCACAGG + Intronic
953917032 3:46926798-46926820 GGACTTTTCTGAGGGACCACTGG - Intronic
962950039 3:140209894-140209916 GGACTTTTCTAAGGACTTACAGG + Intronic
969969399 4:11030271-11030293 GGACATATCTAAGGGAGCATTGG - Intergenic
971591819 4:28478521-28478543 GGACGTCTCTCATGAAGCCCTGG + Intergenic
986345691 5:6833379-6833401 GGAGGTTTCTAAGGAGGCTTTGG - Intergenic
989432427 5:41371541-41371563 GGAAGGGTCTAAGGAAGCAGGGG - Intronic
990618406 5:57531657-57531679 GGATGTTTCTAAGACAGCAAAGG + Intergenic
993505379 5:88702556-88702578 TGACATTTCTAAAGAAGCAAAGG + Intergenic
994819892 5:104635738-104635760 GGAAGTGTCTAAGGCAGCATGGG - Intergenic
995416222 5:111916414-111916436 AGACTTTTCTAAGGCAGCAATGG - Intronic
1000044953 5:157514633-157514655 AGACATTTCTAACCAAGCACAGG + Intronic
1000529596 5:162402967-162402989 AGAGGTGTCTAAGGAAGCAGGGG - Intergenic
1004042530 6:11994864-11994886 GGATCTTTCTTAGGAAGCCCCGG + Intergenic
1004932080 6:20472303-20472325 GGATGTTGCTATGGAAGCAGAGG + Intronic
1006658639 6:35619937-35619959 ACACGTTTCTAAGAAAGCACTGG + Intronic
1017153827 6:151305119-151305141 GGACTTCTCTGAGGAAGCAATGG - Intronic
1019931034 7:4223328-4223350 GGACTTTGCTAAGGCAGCCCTGG - Intronic
1021849908 7:24797337-24797359 GGAAGTCTCACAGGAAGCACAGG + Exonic
1024791484 7:52969566-52969588 GGAGTTTTCTTAGGATGCACTGG - Intergenic
1029953454 7:104611884-104611906 TGAAGTGTATAAGGAAGCACAGG - Intronic
1029958802 7:104668252-104668274 GGACGTTGCTGATCAAGCACTGG + Intronic
1035307751 7:157944032-157944054 CAATGTTTCTAAGGGAGCACTGG + Intronic
1052945288 9:34163492-34163514 GGACCTTTTTGAGGAAGGACTGG + Intergenic
1057008442 9:91581289-91581311 GGAGGTTTGTAGGGAAGGACAGG - Intronic
1057563370 9:96146510-96146532 GGACGTTGCTGATCAAGCACAGG + Intergenic
1059497484 9:114721474-114721496 GGAGGCTTCCAAGGAGGCACTGG - Intergenic
1062197456 9:135282197-135282219 TGAGGTCTCTCAGGAAGCACCGG - Intergenic
1187287846 X:17923172-17923194 GGAGGTTTCCAAGGAAGGACGGG + Intergenic
1191904664 X:66075831-66075853 GGACGTTGCTGATCAAGCACAGG - Intergenic
1196048976 X:111284922-111284944 GAACGTTTCAGAGGAAGCACAGG + Intergenic
1198097076 X:133390510-133390532 GGAAGTTTCCAAGGAGGGACAGG + Intronic
1199289166 X:146087191-146087213 TGACTTTTCTATGGCAGCACTGG - Intergenic
1202093662 Y:21221212-21221234 GGAAGTGTCTAAAGAAGCAAAGG - Intergenic