ID: 1120779088

View in Genome Browser
Species Human (GRCh38)
Location 14:88469722-88469744
Sequence ATCTTTAACAGGAGGGTGGA AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 231
Summary {0: 1, 1: 0, 2: 0, 3: 23, 4: 207}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120779088_1120779095 11 Left 1120779088 14:88469722-88469744 CCTTCCACCCTCCTGTTAAAGAT 0: 1
1: 0
2: 0
3: 23
4: 207
Right 1120779095 14:88469756-88469778 AATGACTCGAGATCCGGCAATGG 0: 1
1: 0
2: 0
3: 1
4: 30
1120779088_1120779094 5 Left 1120779088 14:88469722-88469744 CCTTCCACCCTCCTGTTAAAGAT 0: 1
1: 0
2: 0
3: 23
4: 207
Right 1120779094 14:88469750-88469772 TGGTTAAATGACTCGAGATCCGG 0: 1
1: 0
2: 0
3: 7
4: 221

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120779088 Original CRISPR ATCTTTAACAGGAGGGTGGA AGG (reversed) Exonic
900480585 1:2896245-2896267 TCCTTTTACAGGAGGGTGGCGGG - Intergenic
900522096 1:3110788-3110810 CTCTTTAACAGGAGCGTGGGAGG + Intronic
900655150 1:3753148-3753170 ATCTTGAAAAGGAGAGTGAAGGG + Intronic
905124373 1:35707103-35707125 ATCTTAAACTGGAGGAGGGATGG + Intergenic
907633060 1:56104243-56104265 ACCATTAACAGGAGTTTGGAAGG - Intergenic
908342021 1:63191417-63191439 TGCTTTAACAGGTGGGTGAAAGG - Intergenic
908841046 1:68280387-68280409 CTCTTCTACAGGAGGGTAGATGG + Intergenic
909157144 1:72092236-72092258 ATCTTTCTTAGGAGGCTGGAGGG + Intronic
913568092 1:120093156-120093178 ATTTTTATCAAGAGGGTTGAAGG - Intergenic
914288902 1:146254180-146254202 ATTTTTATCAAGAGGGTTGAAGG - Intergenic
914549937 1:148704923-148704945 ATTTTTATCAAGAGGGTTGAAGG - Intergenic
914616804 1:149367103-149367125 ATTTTTATCAAGAGGGTTGAAGG + Intergenic
917297872 1:173540553-173540575 AACTGTAGCAGGAGGCTGGAGGG + Intronic
917843470 1:179001736-179001758 ACCCTTCACAGGAGGGTGGTGGG - Intergenic
919823046 1:201484843-201484865 ATCTTCAGCAGGAGGGTGGGTGG - Intronic
921474202 1:215586352-215586374 ATTTGTAATAGGAAGGTGGATGG + Intronic
921655932 1:217737451-217737473 ATCTTTAAGGGAAGGGAGGAGGG + Intronic
923080213 1:230646138-230646160 GGCTTTAACTGGAGGTTGGAGGG - Intronic
1063505075 10:6590467-6590489 ATATTTAAAAGGAGGGTTGGTGG + Intergenic
1063649517 10:7919012-7919034 AGGTTTAACAGGAAGGTGAAGGG + Intronic
1064188254 10:13182579-13182601 ATCATTAAAAGGACAGTGGAAGG - Intronic
1066611324 10:37251049-37251071 ATCACTAACACGTGGGTGGAGGG + Intronic
1068499539 10:57826102-57826124 AACTATAAGAGGAGGGTGAAAGG + Intergenic
1069565571 10:69461365-69461387 GTATTTCACTGGAGGGTGGAAGG + Intronic
1071668297 10:87582029-87582051 TTCTTTCACTGGTGGGTGGATGG + Intergenic
1072321246 10:94252305-94252327 CTCTTTCACAGGAGGATGGACGG + Exonic
1074352946 10:112755998-112756020 ATCTTTGAAAGGAGGGTGGCAGG - Intronic
1074399903 10:113133407-113133429 ATCCTCAAAAGGAGGATGGAAGG - Intronic
1074663760 10:115693908-115693930 ATCTTTGACAGGAGGGTGCTAGG + Intronic
1075786060 10:125050941-125050963 ATCTGGATGAGGAGGGTGGATGG + Intronic
1077103121 11:830851-830873 TGCTCTAACTGGAGGGTGGAAGG - Exonic
1078051296 11:7967161-7967183 GCCTTTGACAGGAGGCTGGAAGG + Intergenic
1078848400 11:15142057-15142079 ATCTCTCTCAGGAGGCTGGAGGG - Intronic
1079108715 11:17591300-17591322 ACCTCTAACAGGAGCCTGGAGGG - Intronic
1079289281 11:19172702-19172724 ATCTGAAAAAGAAGGGTGGAAGG - Exonic
1079530914 11:21451860-21451882 AGCTTAAACAGGAGGGAGGGAGG + Intronic
1079552975 11:21723874-21723896 ATGTATCACAGGAGGGTGGCAGG - Intergenic
1080943302 11:36943603-36943625 AACTTCAACAGGTGTGTGGAGGG - Intergenic
1083381157 11:62269740-62269762 AACTTTCAGCGGAGGGTGGATGG + Intergenic
1085720613 11:78909479-78909501 ATGTTTAACAGTAGGGTCTATGG - Intronic
1086223857 11:84483658-84483680 ATCTGTAGGAAGAGGGTGGATGG + Intronic
1087736018 11:101835114-101835136 AGCATTAACAGGAGATTGGAAGG + Intronic
1089181314 11:116584730-116584752 AACTTTTACAGGAAGGTGCACGG + Intergenic
1089621019 11:119722307-119722329 GTCTGTAACAGGAGGCTGAAGGG + Intronic
1089701378 11:120246123-120246145 AAATTTAACAAGGGGGTGGAGGG - Intronic
1096639561 12:52983283-52983305 ATCTTTAACAGGGGTTTGTAAGG + Intergenic
1098078187 12:66756011-66756033 ATTTTTAAAAGGATGGGGGAAGG - Intronic
1100671651 12:96819835-96819857 AACTGCAACAGGAGGGTGGGAGG - Intronic
1101145862 12:101839851-101839873 ATTTTTAAAAGGACGGAGGAAGG + Intergenic
1101797327 12:107987338-107987360 AACTTTACCAGAAGGCTGGAAGG + Intergenic
1103179593 12:118898450-118898472 ATGTTTAAGTGGAGTGTGGAAGG + Intergenic
1104211974 12:126697642-126697664 ATTGTTGACAGTAGGGTGGAAGG - Intergenic
1108567677 13:51717131-51717153 TTCTTTAACAGGAGTGGTGAGGG - Intronic
1112690984 13:101893572-101893594 GTCCTTAAAAGGAGAGTGGAAGG + Intronic
1113196806 13:107817905-107817927 ATCTTTTTCAGGTGGATGGATGG - Intronic
1113313131 13:109151953-109151975 GGCTTTAACAGCAGGATGGAGGG + Intronic
1113414102 13:110114411-110114433 ATCTGTCACTGGAGGGTGGCTGG + Intergenic
1115268936 14:31530063-31530085 ATCTGTAACAGGAAGGTGAGGGG - Intronic
1116316099 14:43394332-43394354 CTATTTAACAGGAGGATTGAGGG + Intergenic
1116509307 14:45723921-45723943 AACATTAACAGGAGTTTGGAAGG + Intergenic
1118176554 14:63446288-63446310 AGCATTAACAGGAGTTTGGAAGG - Intronic
1119872685 14:78030510-78030532 GTCTTTTACAGTAGCGTGGATGG + Intergenic
1119932697 14:78563674-78563696 ATCATTTACATGAAGGTGGATGG - Intronic
1120779088 14:88469722-88469744 ATCTTTAACAGGAGGGTGGAAGG - Exonic
1123025237 14:105420827-105420849 GTCTTTCACAGGAAGGTGGGGGG + Intronic
1202882070 14_KI270722v1_random:69720-69742 TTCTTTTTCAGGAGGGAGGAGGG + Intergenic
1124012806 15:25852261-25852283 GCATTTAACAGGAGGGAGGATGG - Intronic
1124583709 15:30986011-30986033 ATTTTTCAGAGGATGGTGGAAGG + Intronic
1124814651 15:32977400-32977422 ATCTTTTTCAGGAGGATGGAGGG - Intronic
1127750131 15:62029670-62029692 GTCTTTGACAGGAGGGTCCAAGG + Intronic
1128689379 15:69711694-69711716 CTCTTTTACAGGACTGTGGAGGG - Intergenic
1129359072 15:75013046-75013068 CTCTGTGAAAGGAGGGTGGAGGG - Intronic
1131627967 15:94144418-94144440 AATTTTAACATGAGGTTGGAGGG - Intergenic
1133570889 16:7038814-7038836 GTCTTTACCAAGAGGGTGCATGG + Intronic
1133779893 16:8929854-8929876 ATCCCTAACAGGAGCGGGGAGGG + Intronic
1133825086 16:9271115-9271137 ATGTATAATAGGTGGGTGGATGG - Intergenic
1133983081 16:10648048-10648070 ATTTTTAACAGGAGGTGGGAGGG - Intronic
1134980527 16:18604943-18604965 ATCTTTCAAAGGAGGCTGAATGG + Intergenic
1141642010 16:85346913-85346935 ATGGTGAACAGGTGGGTGGATGG + Intergenic
1143304910 17:5938798-5938820 ATCTTTTAAAGGAGGGAGGGAGG + Intronic
1145352911 17:22103817-22103839 ATCTTTTACAGGAAGGGTGAAGG + Intergenic
1146556789 17:33831826-33831848 ATCTTGAAGAGGAGAGAGGAGGG + Intronic
1146639898 17:34532474-34532496 ATCTTTAACTGGAGGGAGCACGG - Intergenic
1151190348 17:72393595-72393617 ATCTTTGGAAGAAGGGTGGAGGG + Intergenic
1151773542 17:76181358-76181380 ATCTTTAACAGGAGTATCTAAGG + Intronic
1152502569 17:80722430-80722452 GTTTTTAAGGGGAGGGTGGAAGG + Intronic
1152559520 17:81070961-81070983 ATCTTGGACATGGGGGTGGAGGG - Intronic
1153068410 18:1075931-1075953 TTCTTCAACAGGATGGGGGAAGG + Intergenic
1156501212 18:37559753-37559775 ATCTATATCAGGAGGGAAGAGGG - Intronic
1159386339 18:67729836-67729858 ATCTTTAATATCAGGGTGGGTGG + Intergenic
1160532435 18:79573425-79573447 ATCTAGAAGAGGAGGCTGGAAGG + Intergenic
1165076747 19:33283563-33283585 AGCTTCAAGAGAAGGGTGGAGGG - Intergenic
1165723033 19:38093170-38093192 ATTTTTAACAGGAAGGTCAAGGG + Intronic
1202631173 1_KI270706v1_random:1179-1201 TTCTTTTTCAGGAGGGAGGAGGG + Intergenic
1202657684 1_KI270708v1_random:38818-38840 TTCTTTTTCAGGAGGGAGGAGGG + Intergenic
925898243 2:8489433-8489455 AGCTTGCACAGCAGGGTGGATGG + Intergenic
927381867 2:22488734-22488756 ATTTTTATCAGGAGGTTGAAGGG - Intergenic
928216692 2:29367415-29367437 ATCTGTAAAATGAGGGAGGAAGG + Intronic
929235556 2:39601700-39601722 ATCTCTAACATTAGGGTTGATGG + Intergenic
931791257 2:65666198-65666220 ATCTTTAAAAGGAGGTGGCATGG + Intergenic
931898461 2:66761025-66761047 TTTTATAACAGAAGGGTGGATGG + Intergenic
932414560 2:71565763-71565785 ATCTGTAAAATGAGGGTGGGTGG + Intronic
932807048 2:74793295-74793317 CTGTCTAACAGGAGGGTGGGTGG + Intergenic
937241592 2:120465654-120465676 ATATTTAACAGCTGAGTGGATGG - Intergenic
937692012 2:124767300-124767322 ATCTTTGAAAGCAGGCTGGAAGG - Intronic
939731893 2:145795056-145795078 ATATTTCAGAGGAGAGTGGATGG - Intergenic
941233721 2:162943295-162943317 GTATTTAACCTGAGGGTGGAGGG - Intergenic
948916721 2:241038040-241038062 TTCTTTACCAGGTGGGTGAAGGG - Intronic
948982922 2:241503995-241504017 TTCCTAACCAGGAGGGTGGAAGG + Intronic
1169990708 20:11499521-11499543 ATCTTTAACAGTAGCATGGCAGG + Intergenic
1173070015 20:39754774-39754796 ATTTTTAACAAGCGGGTGGTGGG + Intergenic
1173872531 20:46350939-46350961 TGCTTGACCAGGAGGGTGGAAGG + Intronic
1174457316 20:50658761-50658783 ATCTTTTAAAGAAGGCTGGAGGG - Intronic
1175653756 20:60751005-60751027 ATATTTAACAGAAGGGAAGAAGG + Intergenic
1176597563 21:8761155-8761177 TTCTTTTTCAGGAGGGAGGAGGG + Intergenic
1176643395 21:9327119-9327141 TTCTTTTTCAGGAGGGAGGAGGG + Intergenic
1178956006 21:37022509-37022531 ATCCTTTGCAGGAGTGTGGATGG - Intergenic
1179285519 21:39974612-39974634 ACCTATAAGAGAAGGGTGGAGGG - Intergenic
1179285532 21:39974686-39974708 ACCTATAAGAGAAGGGTGGAGGG - Intergenic
1179285545 21:39974760-39974782 ACCTATAAGAGAAGGGTGGAGGG - Intergenic
1179285558 21:39974834-39974856 ACCTATAAGAGAAGGGTGGAGGG - Intergenic
1179285571 21:39974908-39974930 ACCTATAAGAGAAGGGTGGAGGG - Intergenic
1179285584 21:39974982-39975004 ACCTATAAGAGAAGGGTGGAGGG - Intergenic
1179285597 21:39975056-39975078 ACCTATAAGAGAAGGGTGGAGGG - Intergenic
1179285610 21:39975130-39975152 CCCTATAAGAGGAGGGTGGAGGG - Intergenic
1180369539 22:11972097-11972119 GTCTTTTTCAGGAGGGAGGAGGG - Intergenic
1180376691 22:12100013-12100035 TTCTTTTTCAGGAGGGAGGAGGG + Intergenic
1180420881 22:12813682-12813704 TTCTTTTTCAGGAGGGAGGAGGG - Intergenic
949652257 3:6173488-6173510 ATCTTTAACAAGAGACAGGAGGG + Intergenic
951604767 3:24421038-24421060 ATCTTTTGCAGGAAGATGGATGG + Intronic
951832799 3:26949312-26949334 ATCTTTTAGAGGAGGTAGGAGGG - Intergenic
952268350 3:31808212-31808234 AGGTTTGACAGGAGGTTGGAGGG + Intronic
954799725 3:53180339-53180361 ATCTTTAACAGCAAGGAGGTGGG + Intronic
956899771 3:73703349-73703371 AGCTCTAACAGGAGGGTGTGTGG + Intergenic
956998077 3:74851067-74851089 TTCTTTAAATGGAGGGTGGTTGG - Intergenic
957096666 3:75783463-75783485 TTCTTTTTCAGGAGGGAGGAGGG - Intronic
957172761 3:76760010-76760032 AACTCTAACAGAAGGATGGAAGG + Intronic
961101124 3:124200053-124200075 ATCATAAACAGGAAGGTGGGTGG + Intronic
961552687 3:127678102-127678124 TTCTCTAGCAGGAGGGTGGAGGG + Intronic
961870405 3:129983629-129983651 AACATTAACAGGAGGCAGGAAGG - Intergenic
963853027 3:150226523-150226545 AGCTATAACTGTAGGGTGGAGGG + Intergenic
964870482 3:161308766-161308788 ATCATTAACAGGAGTGTGAAAGG + Intergenic
966959721 3:184923139-184923161 ATCTTTGAATGGAGGGTGGAAGG + Intronic
967193517 3:187005938-187005960 ATCTTTGACAAGATGGTGGGGGG + Intronic
967881670 3:194306013-194306035 ATGTTTAAGAGGAGGCTGGCGGG + Intergenic
1202743486 3_GL000221v1_random:77910-77932 TTCTTTTTCAGGAGGGAGGAGGG - Intergenic
970925518 4:21447168-21447190 ATCTTTAACAGAAAGGTAGAAGG + Intronic
972146456 4:36032977-36032999 GTCTTTTACAGGAATGTGGATGG - Intronic
973360860 4:49163367-49163389 TTCTTTTTCAGGAGGGAGGAGGG + Intergenic
973739264 4:53903329-53903351 ATCTTAAACAGAAGGAGGGAAGG + Intronic
975809705 4:78154480-78154502 AGCTTTAAAAGGTGGGTGGTGGG - Intronic
976609483 4:87015246-87015268 AACTCTAAAAGGAGGCTGGAGGG - Intronic
980548642 4:134303669-134303691 GTCTTTAGCAGGAGCATGGATGG - Intergenic
981459223 4:144992460-144992482 AACTTTAACAGGAGTTTGGAAGG + Intronic
982164897 4:152605348-152605370 AACTCCAACAGTAGGGTGGAGGG + Intergenic
988974708 5:36503732-36503754 ATCTTCCCCTGGAGGGTGGATGG - Intergenic
989465594 5:41751562-41751584 ATCTTTCAAGGTAGGGTGGATGG - Intronic
990956758 5:61348469-61348491 ATCTTTAACAGGAAGTATGAAGG - Intronic
991094186 5:62721810-62721832 ATCTATAATAGAAGAGTGGAAGG + Intergenic
993219725 5:85076563-85076585 ATCTTTTACAGGAATATGGATGG - Intergenic
993894834 5:93522047-93522069 ATCTTTCACAGGAACATGGATGG + Intergenic
995508800 5:112887205-112887227 ATGGGTAACAGGAGGGTGGAGGG + Intronic
996399520 5:123046413-123046435 ATCCTTAGAAGGAGGGTGGATGG - Intergenic
996606243 5:125327015-125327037 ATAATTAGCAGGAGTGTGGAAGG - Intergenic
996701032 5:126450636-126450658 TTTTTTAACAGCAGGCTGGATGG - Intronic
998842315 5:146268172-146268194 AGATTTAACAGGAGGGTGGGAGG + Intronic
999707620 5:154288070-154288092 TTCTTTGAGAGGAAGGTGGAGGG + Intronic
1001653105 5:173329163-173329185 ATCATTTCCAGGAGGGTGGCAGG + Exonic
1004719949 6:18260512-18260534 GTCTTTGGCAGGTGGGTGGATGG - Intronic
1007265878 6:40595534-40595556 AGCTGTGAAAGGAGGGTGGAAGG + Intergenic
1008090295 6:47286688-47286710 ATCTTTAACAGGAATGATGATGG - Intronic
1008778941 6:55077926-55077948 ATCTTTTACAGGAACATGGATGG + Intergenic
1009497137 6:64364741-64364763 AACTTTAAAAGGTGGGTGGGTGG + Intronic
1009622370 6:66094490-66094512 ATTTTTAACTGAAGGGTTGAAGG + Intergenic
1010767300 6:79790738-79790760 ATATTTAATAAGAGTGTGGATGG + Intergenic
1011184660 6:84660961-84660983 ATTTTTGAGAGGAGGGTGGGAGG + Intergenic
1012813101 6:103985888-103985910 AAGTTAAGCAGGAGGGTGGAAGG - Intergenic
1013172790 6:107652279-107652301 AACATTAACAGGAGTTTGGAAGG + Intronic
1014127263 6:117791223-117791245 ATCCTTTACAGGAAGATGGATGG + Intergenic
1015116975 6:129660444-129660466 TTCTTGGACAGGAGGGTAGATGG + Intronic
1015640818 6:135329837-135329859 AACATTAACAGGGGTGTGGAAGG + Intronic
1015754246 6:136591705-136591727 ATATTTAAAAGGAGGGTGAAGGG - Intronic
1017008023 6:150042021-150042043 ATCTTTATCTGCAGGGTGGGAGG + Intergenic
1018312736 6:162527720-162527742 ATTTTTAAAAGGAGTGAGGAGGG + Intronic
1020463959 7:8455472-8455494 AGCTTTAGCAGAAGGGTGAAAGG + Intronic
1022229506 7:28400121-28400143 ATGTTAAGCAGGAGGGTGAAAGG + Intronic
1022385025 7:29891733-29891755 ATCTATCTCAGGAGGGTGGTGGG - Intronic
1022469651 7:30674470-30674492 ATCTGCACCAGGTGGGTGGAGGG - Intronic
1022569311 7:31435603-31435625 ATCATGAACAGTTGGGTGGATGG + Intergenic
1027000371 7:74648911-74648933 CTCTTTAGCATGAGGGTGGAGGG + Intergenic
1027591076 7:80119932-80119954 ATTTTTAACAGGAAGGGGAATGG - Intergenic
1029088060 7:98026716-98026738 ATCTTTAAAAGGAAGGGGGAAGG - Intergenic
1030104441 7:105975091-105975113 ATCCTGAAAATGAGGGTGGATGG + Intronic
1031057762 7:117011875-117011897 TTCTTTGAGAGGTGGGTGGAGGG + Intronic
1031173675 7:118322176-118322198 ATCTTTAAGAGGATTGTGGAAGG + Intergenic
1032330163 7:130971313-130971335 CACTTTAAAAGGAGGGTGAAGGG + Intergenic
1034505679 7:151488280-151488302 ATCTTTAACAGTAGGGGTGTAGG - Intronic
1038892600 8:31743251-31743273 ATATTCTGCAGGAGGGTGGAAGG + Intronic
1039750692 8:40475584-40475606 ATTTTTAAAAGAAGGGTGGGGGG + Intergenic
1039847773 8:41337804-41337826 ATCTTTATCAGCAGGGAGAAAGG - Intergenic
1041403825 8:57474012-57474034 ATCTTAAAGAGGTGGGTGCAAGG - Intergenic
1042060148 8:64807722-64807744 ATCTTTAAGAATAGGCTGGAGGG - Intergenic
1045592890 8:103618175-103618197 ATCTTTTGCAGGAGCATGGATGG + Intronic
1046678392 8:117138492-117138514 ATCTTTAACTGGAAGCTGGGAGG - Intronic
1048604481 8:135953291-135953313 ATCTATAATATGGGGGTGGATGG + Intergenic
1049406966 8:142455896-142455918 CTCTGTGACAGGAGGGTGGGTGG + Intronic
1050051673 9:1608601-1608623 ATCCTCAAAAGGAAGGTGGAGGG + Intergenic
1051331723 9:16030862-16030884 ATTTTTTTCAAGAGGGTGGAGGG + Intronic
1054725860 9:68649419-68649441 GGGTTTCACAGGAGGGTGGATGG - Intergenic
1055642775 9:78333432-78333454 AGCTCTAAGAGGAGGGAGGAGGG - Intergenic
1055761238 9:79610632-79610654 ATCTTTAACGGAAGTTTGGAAGG + Intronic
1055777851 9:79785191-79785213 ACCTTTAAGAGGATGGTGGCTGG + Intergenic
1058340713 9:103892883-103892905 ATCTTTAACAGGAACATGGATGG + Intergenic
1060465524 9:123901381-123901403 ATTTTTAATAGGAGGGTAGAGGG - Intronic
1203712122 Un_KI270742v1:107874-107896 TTCTTTTTCAGGAGGGAGGAGGG - Intergenic
1203539082 Un_KI270743v1:70318-70340 TTCTTTTTCAGGAGGGAGGAGGG + Intergenic
1203555734 Un_KI270743v1:206206-206228 TTCTTTTTCAGGAGGGAGGAGGG - Intergenic
1187166103 X:16805280-16805302 ATTTTTAAAAAGGGGGTGGAGGG - Intronic
1188513553 X:30961530-30961552 TTCTTTAACAAGAAGGTAGATGG + Intronic
1189035550 X:37491296-37491318 CCCATGAACAGGAGGGTGGAGGG - Intronic
1189211387 X:39286964-39286986 ATCATTAATGGGAGGCTGGAGGG - Intergenic
1189858021 X:45243048-45243070 ATCCTTTACAGGAGCATGGATGG - Intergenic
1190909234 X:54756966-54756988 ATCTTCATCAGGAGTGAGGAAGG + Exonic
1191736003 X:64388407-64388429 ATATGTAACAGGAGGAAGGAAGG + Intronic
1194057021 X:89148109-89148131 ATCTTTTACAGCAGCGTGGATGG + Intergenic
1194966508 X:100294457-100294479 TTCTTTTACAGGAGGGAGAAGGG - Exonic
1194994015 X:100573691-100573713 ATCTTTCTAAGGAGGGTGTAGGG + Intergenic
1195135535 X:101903942-101903964 ATATTTAATACAAGGGTGGATGG + Intronic
1197918516 X:131562472-131562494 ATCTTTAAAATGAGGGAGGTTGG - Intergenic
1198072953 X:133167647-133167669 ATTTTTTACACTAGGGTGGAAGG + Intergenic
1199029574 X:142980982-142981004 ATCTTTAAAGGGAAAGTGGATGG - Intergenic