ID: 1120780158

View in Genome Browser
Species Human (GRCh38)
Location 14:88479579-88479601
Sequence GCAGCGAGTGCGCCACGGGC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 122
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 114}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120780148_1120780158 30 Left 1120780148 14:88479526-88479548 CCGTTTGTGCAGCTGCGCGTGGC 0: 1
1: 0
2: 0
3: 4
4: 86
Right 1120780158 14:88479579-88479601 GCAGCGAGTGCGCCACGGGCAGG 0: 1
1: 0
2: 0
3: 7
4: 114

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120780158 Original CRISPR GCAGCGAGTGCGCCACGGGC AGG Exonic
900169375 1:1258853-1258875 CCAGCGTGTGGGCCTCGGGCTGG - Intronic
900182145 1:1315793-1315815 GCAGCGAGGGAGGCAGGGGCAGG + Intronic
900393519 1:2443894-2443916 GCAGCGAGGGCGGCGGGGGCGGG - Intronic
902823270 1:18956317-18956339 GCAGCGAGTTCACCATGCGCCGG + Exonic
905580533 1:39080854-39080876 GGAGCAAGAGCGCCAAGGGCGGG + Intergenic
911664757 1:100539761-100539783 GCAGCGCGGGCGGCAGGGGCTGG - Exonic
915970775 1:160353571-160353593 GCAGCGAGTGTGACACAGCCAGG - Intronic
920225915 1:204438970-204438992 GCAGCCAGTCTGCCAGGGGCCGG + Exonic
1065024247 10:21526153-21526175 GCAGCGAGTCCGCGCGGGGCGGG + Intergenic
1068690182 10:59906389-59906411 CCAGCGAGAGCGACACGGACGGG - Exonic
1070331841 10:75423096-75423118 GCAGCAAGTGCACGTCGGGCTGG - Intergenic
1076166582 10:128286972-128286994 GCAGGGAGGGCGCCCCTGGCCGG - Intergenic
1076658465 10:132039564-132039586 GAAGCCAGTGAGCCACAGGCAGG - Intergenic
1076736555 10:132461679-132461701 GCAGTTAGGGCGGCACGGGCTGG + Intergenic
1076875190 10:133212499-133212521 TCAGCAGGTGCCCCACGGGCAGG - Intronic
1077886250 11:6390294-6390316 GCAGCCCGTGCGCCCGGGGCAGG + Intergenic
1081870665 11:46381372-46381394 GCAGGGAGTGGGCCGGGGGCCGG + Intronic
1083465029 11:62839607-62839629 GCAGCGTGTGCGTCACCAGCGGG + Exonic
1084156931 11:67318270-67318292 GCAGTGAGTGCGCCCGGGGCTGG + Intronic
1102001990 12:109563202-109563224 GCAGCGTGTACCCCAAGGGCTGG + Intronic
1103733265 12:123042593-123042615 GAAGCGAGGGAGCCACCGGCAGG + Intronic
1104993390 12:132639589-132639611 GCAGCAAGTGTGTGACGGGCCGG + Intronic
1105418428 13:20232434-20232456 GCGGCTAGTGCGCCCCGGGTAGG - Intergenic
1107468057 13:40666734-40666756 GCAGCCAGTGGGCGCCGGGCTGG + Intergenic
1114529410 14:23386476-23386498 GCAGCGAGTCCACCACCCGCTGG + Exonic
1114534812 14:23416165-23416187 GCAGCGAGTCCACCACCCGCAGG + Exonic
1117584816 14:57190461-57190483 GCATTGAGTGAGCCACAGGCAGG - Intergenic
1118376836 14:65184745-65184767 GCAGCTAGTGCGTCACTGCCTGG + Intergenic
1118590212 14:67395382-67395404 GCAGTGAGTGCCCCACTTGCCGG - Exonic
1119602548 14:75986181-75986203 GGAGCGAGTGCGACCCCGGCCGG - Intronic
1120780158 14:88479579-88479601 GCAGCGAGTGCGCCACGGGCAGG + Exonic
1123898028 15:24848140-24848162 GCAGCAAATGCGCCACTGTCCGG + Intronic
1124629208 15:31327460-31327482 GCAGGGAGGGCGCCGCGGCCCGG + Exonic
1127850798 15:62910285-62910307 GCAGTGAGTGTGTCACAGGCAGG - Intergenic
1128149843 15:65355891-65355913 GCCGCGAGTGCGCCGGGGCCGGG - Intronic
1129761471 15:78131418-78131440 GCAGCGACTCCGCCGCCGGCGGG + Exonic
1132398280 15:101489699-101489721 GCTGCGAGTGCGCCGGGGGGTGG + Exonic
1132578723 16:675621-675643 GCGGCGTGTGCGGCAGGGGCGGG + Intronic
1132807807 16:1783097-1783119 GCAGCGAGGCCGCCCCGGGAAGG - Intronic
1132889433 16:2196613-2196635 GCGGGGAGCGCGTCACGGGCGGG + Intergenic
1136994301 16:35177693-35177715 GCACCTTGTGGGCCACGGGCTGG + Intergenic
1138622564 16:58223611-58223633 GCAGCGAGTGCCAGACCGGCAGG + Intergenic
1140025720 16:71289070-71289092 CCAGCGGGTGAGCCAGGGGCTGG - Intronic
1140827627 16:78722149-78722171 ACAGGGAGTGAGCCACGTGCTGG - Intronic
1142671750 17:1490901-1490923 GCAGGGAGAGTGCCCCGGGCTGG - Intronic
1142773932 17:2121063-2121085 GCAGCCTGTGGGCCACGGGTTGG + Intronic
1143020250 17:3913878-3913900 GCAACCCGTGCCCCACGGGCCGG + Intronic
1151231256 17:72686678-72686700 TCAGCGTGTGCTCCACAGGCAGG + Intronic
1153935321 18:9914894-9914916 GCAGCGAGCTCTCCCCGGGCCGG - Intronic
1154954532 18:21241948-21241970 GCATCGAGGGCTCCACAGGCTGG + Intergenic
1157422897 18:47560854-47560876 GCAGGGATAGCGCCACAGGCTGG + Intergenic
1160371437 18:78375363-78375385 TCAGCGGGAGCCCCACGGGCAGG + Intergenic
1160464957 18:79069024-79069046 GGCGCGCGTGCGCCACAGGCTGG - Intergenic
1160792619 19:929570-929592 GCAGCGGGCGCGCCAGGAGCTGG + Exonic
1160864441 19:1250724-1250746 GCTGCGAGGGCGTCCCGGGCCGG + Intronic
1162021219 19:7869430-7869452 GGATCCAGTGCGCCAGGGGCGGG + Exonic
1163368687 19:16889988-16890010 GCAGCGGGTGCACCAGGGCCAGG - Exonic
1163933886 19:20424255-20424277 GCAGCGAGTGTGCCCCGGCCTGG - Intergenic
1165838510 19:38773389-38773411 GCAGTGAGTGTGCCACGGACTGG - Intronic
1165841049 19:38789308-38789330 GCAGTGAGTGTGCCACGGACTGG + Intronic
1166231417 19:41427440-41427462 GCAGGGAGGGCCCCAGGGGCCGG + Exonic
1166738205 19:45098466-45098488 GCAGGGAGTGAGTCACCGGCAGG - Intronic
1167756742 19:51417525-51417547 GCGGTGAGTGGGCCAAGGGCCGG - Exonic
928089052 2:28363120-28363142 GCAGCAAGTGCCCCAGGGGCAGG + Intergenic
932682261 2:73836399-73836421 GCAGCGCGGGCACCACGGGGTGG - Intronic
941906173 2:170717089-170717111 GCAGCACGTGTGCCACGTGCCGG + Exonic
943101811 2:183496063-183496085 GCAGCGACTGCACCTCAGGCAGG - Intergenic
943639677 2:190344143-190344165 GCAGCGAGGCCGCCCCCGGCCGG + Intronic
948473795 2:238203638-238203660 GCAGCGGGCGGGCGACGGGCAGG + Exonic
948840676 2:240647325-240647347 GCATTGAGTGCGCCCAGGGCAGG - Intergenic
948989841 2:241548221-241548243 TCAGCCAGTGCGGCATGGGCAGG - Intergenic
1173166236 20:40688959-40688981 GGAGCGAGGGCGCAGCGGGCCGG + Exonic
1173460265 20:43237626-43237648 GCAGAGAGTTCTCCATGGGCAGG - Intergenic
1176374555 21:6080617-6080639 ACAGCGCGTGGGCCAGGGGCCGG + Intergenic
1179529808 21:42010679-42010701 GCAGCAAGGGCGCCTCCGGCAGG - Intergenic
1179748920 21:43457628-43457650 ACAGCGCGTGGGCCAGGGGCCGG - Intergenic
1180178054 21:46099645-46099667 CCAGCCAGTGCCCCGCGGGCTGG - Intronic
1180180930 21:46118413-46118435 GCAGAGTGTGTGTCACGGGCAGG - Intronic
1182288139 22:29260032-29260054 GCAGAGAGTGGGGCACAGGCAGG - Exonic
1183441326 22:37824726-37824748 GCAGCGGGTGCCGCACGGCCAGG - Exonic
1185040635 22:48502051-48502073 ACAGCGGGTGGGCCACAGGCTGG - Intronic
1185188647 22:49418648-49418670 GCAGCACCTGCGCCAGGGGCAGG + Intronic
953406964 3:42664463-42664485 GCAGTGCGTGCGCCTGGGGCTGG - Exonic
955997060 3:64688177-64688199 GCTGCGAGTCCCGCACGGGCCGG - Intergenic
961372743 3:126441319-126441341 GCTGCTAGTGCGCCACAAGCAGG + Intronic
968643352 4:1726175-1726197 GCAGCGAGTGCCCCAGAGACAGG + Intronic
968756499 4:2418758-2418780 GCAGGGAGCGCGCCTCGGGCGGG - Intergenic
969574826 4:8030671-8030693 CGAGAGAGTGCGCCCCGGGCTGG - Intronic
974069445 4:57110478-57110500 GCCGGGAGGGCGGCACGGGCGGG - Intergenic
978007907 4:103640645-103640667 GCAGCCTGTGGGCCACGGGTTGG - Intronic
978293448 4:107174464-107174486 GCAGCCTGTGGGCCATGGGCTGG - Intronic
981475163 4:145180359-145180381 CCAGCGTGCGCGCCAGGGGCGGG - Intergenic
984698230 4:182800162-182800184 GCAGCGCGTGCGCGACGGCGAGG + Exonic
992075400 5:73188248-73188270 GCAGCCTGTGGGCCACGGGTTGG + Intergenic
995408605 5:111830054-111830076 GCAGCCTGTGGGCCATGGGCTGG - Intronic
995445552 5:112239003-112239025 GCAGCTAGAGCGCCAGGGGATGG + Intronic
998265534 5:140665054-140665076 GCAGCCAGTAGGTCACGGGCCGG - Exonic
999375900 5:151086329-151086351 ACAGGGAGTGGGCCAAGGGCAGG - Intronic
999716382 5:154364212-154364234 GCAGAGAATGCACCAGGGGCAGG + Intronic
1005999725 6:30955639-30955661 GGAGCGAGTGCCCCGAGGGCAGG + Intergenic
1006665229 6:35688707-35688729 GCAGCGAGTGCGACCGCGGCGGG + Intronic
1006672484 6:35738037-35738059 CGAGCGAGAGCGGCACGGGCGGG + Exonic
1014098200 6:117482658-117482680 GCAGCGACTGCGCCCCGTCCCGG + Exonic
1018872999 6:167797142-167797164 CCAGCGCGTGCGCCGCGGCCAGG - Intergenic
1019058739 6:169241068-169241090 GCAGGGAGGGCGGCAGGGGCAGG - Intronic
1033220462 7:139523854-139523876 GCGCCGAGTGCGCGTCGGGCTGG + Exonic
1034493954 7:151409470-151409492 GCAGCGAGGACGGCACGGCCCGG - Exonic
1044666446 8:94639100-94639122 GCACCGAGAGCCCCACGGGGAGG + Intergenic
1045510156 8:102807186-102807208 GCAGCGCGAGCGACACGGGGCGG - Intergenic
1049616625 8:143578368-143578390 ACAGGGAGTGCGCCATAGGCCGG - Exonic
1049670919 8:143869513-143869535 GCAGCCTGTGCCCCACAGGCAGG + Exonic
1049788233 8:144461534-144461556 GCAGCCAGTGCTCCAGGAGCCGG - Intronic
1053430720 9:38040239-38040261 GCCTCGACTGCGCCACTGGCTGG + Intronic
1054077005 9:60546199-60546221 GCAGCCAGTGCACCACTTGCAGG - Intergenic
1061059850 9:128244938-128244960 GCAGAGAGGGGACCACGGGCTGG - Intronic
1061609881 9:131739549-131739571 GCTGCGGGGGCGCCAGGGGCCGG - Intronic
1061792125 9:133064382-133064404 GCTGCGAGGGAGACACGGGCAGG - Exonic
1062080200 9:134619737-134619759 GCACTGAGGGCCCCACGGGCAGG - Intergenic
1062426440 9:136508290-136508312 GCTGCGAGTGCCCCAGCGGCTGG - Exonic
1185623312 X:1466462-1466484 CCAGCGAGTACACCACGGGCAGG + Exonic
1189318684 X:40074185-40074207 GCAGCGAGTTCCCCGCGGCCAGG - Exonic
1201663767 Y:16426253-16426275 GCAGCCAGTGCTCTAAGGGCTGG - Intergenic