ID: 1120783865

View in Genome Browser
Species Human (GRCh38)
Location 14:88512280-88512302
Sequence ATGAAGATGTTCATTTTGTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 464
Summary {0: 1, 1: 0, 2: 5, 3: 39, 4: 419}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120783865 Original CRISPR ATGAAGATGTTCATTTTGTT GGG (reversed) Intronic
903136205 1:21310850-21310872 ATGAAGATTTTCATCCTGGTTGG - Intronic
905903324 1:41596649-41596671 ATCAATATGTTTGTTTTGTTTGG - Intronic
906764063 1:48410289-48410311 ATGAAGATGAGAAATTTGTTGGG - Intronic
909519884 1:76555509-76555531 ATGACCAGGTTCACTTTGTTTGG - Intronic
909751319 1:79165206-79165228 ATGGAGATGATGAATTTGTTGGG + Intergenic
909796276 1:79740743-79740765 CTGAAGATGTTCATATTGAAGGG - Intergenic
910377700 1:86591426-86591448 GTGAAGATGTTAAAGTTGTTTGG + Intergenic
910575848 1:88763059-88763081 AGAAAGACATTCATTTTGTTTGG + Intronic
910603468 1:89056541-89056563 ATGAAAATTTTCTTTGTGTTTGG + Intronic
910954620 1:92688465-92688487 CTGAAATTGTTCATTTTGTTTGG + Intronic
911313165 1:96322464-96322486 ATGAAGAAGTTTATTTTATGAGG + Intergenic
911415588 1:97568258-97568280 ATGTAGCTATTCATGTTGTTTGG - Intronic
913349243 1:117839830-117839852 GTGGACATGTTCATTTTTTTTGG - Intergenic
916503355 1:165405995-165406017 TTGAAGACATTAATTTTGTTTGG - Intronic
917128994 1:171721044-171721066 ATTGAGATGATCATTTTTTTTGG - Intronic
917365565 1:174228640-174228662 ATGAAGTAGTTCATTTTGAATGG + Intronic
917445163 1:175100581-175100603 ATGTAGATATCCATTTTCTTGGG + Intronic
917599684 1:176561720-176561742 GTGAACATGTTCATTTTTCTAGG - Intronic
917830735 1:178882424-178882446 ATGAAGATGTTTAATTATTTAGG - Intronic
918659479 1:187072158-187072180 GTCAAGATGTTGATTTTTTTTGG + Intergenic
918941357 1:191002214-191002236 ATGAAGCTGTGAACTTTGTTTGG - Intergenic
919612465 1:199761941-199761963 ATGATTGTATTCATTTTGTTTGG + Intergenic
920346275 1:205307616-205307638 ATGGAGAAGTTCATGTTGATGGG - Intronic
923659927 1:235949239-235949261 ATGAAGGAGTTTATTTTGCTTGG - Intergenic
923726027 1:236506153-236506175 ATAAAGATGTTCATTCTTTGTGG + Intergenic
923864224 1:237921737-237921759 ATAAAAATATTCATTTTGTGAGG + Intergenic
924633851 1:245766528-245766550 ATAATGATGTTCATTTCGTAAGG - Intronic
1063228252 10:4036448-4036470 CTGATGAAGTTCACTTTGTTTGG - Intergenic
1063582989 10:7326143-7326165 ATGAAGATGGCTCTTTTGTTTGG - Intronic
1064068215 10:12201980-12202002 ATGAAGATGGTCATTTGCTCAGG + Intronic
1064574088 10:16726817-16726839 ATAAAGAGGTCCATTTTTTTAGG - Intronic
1065056985 10:21855835-21855857 GGGAAGATGTTCATTTTGATAGG + Intronic
1065166862 10:22988617-22988639 ATGATGATGGTCATTTTGAAGGG + Intronic
1066258460 10:33704791-33704813 ATGTCAATGTTCATTTTGCTGGG - Intergenic
1067465270 10:46493466-46493488 ATTAATATGTTCCTTTTGTCAGG + Intergenic
1067621917 10:47891135-47891157 ATTAATATGTTCCTTTTGTCAGG - Intergenic
1067676562 10:48384664-48384686 TTGAAGGTGTACATTTTATTTGG - Intronic
1067915638 10:50395165-50395187 ATGAAGGTGTTTTTTTTCTTGGG - Intronic
1068586333 10:58803616-58803638 ATGAAGATGATGAATGTGTTTGG + Intronic
1069469713 10:68677109-68677131 AAGCAGATGTTATTTTTGTTTGG - Intronic
1071088483 10:81891987-81892009 ATGAAGATTTTGTTTTTGTTTGG + Intronic
1071221423 10:83470175-83470197 ATGTAGATGCTATTTTTGTTGGG - Intergenic
1071727447 10:88213679-88213701 ATTTAGATGTTTCTTTTGTTTGG + Intergenic
1071815472 10:89227981-89228003 ATTAAGATTTACATTTAGTTAGG - Intronic
1072281908 10:93873081-93873103 ATGAATATATTCATATTGTAAGG - Intergenic
1073636355 10:105202568-105202590 AAAAACATGTTCATTTTGTACGG - Intronic
1073777672 10:106804392-106804414 GTTAAGATTTTCAATTTGTTAGG - Intronic
1074415275 10:113262015-113262037 ATGCAGCTGTTCATTTGGTTTGG + Intergenic
1075392700 10:122104093-122104115 ATTAAGACCTACATTTTGTTAGG - Intronic
1077985116 11:7343494-7343516 ATGAAGATGAGGAATTTGTTGGG - Intronic
1078286113 11:9957816-9957838 AAGAAGAGGTTCTTTTTGCTTGG - Intronic
1079326162 11:19494417-19494439 ATGAATATGTGCTCTTTGTTAGG + Intronic
1079773922 11:24499039-24499061 ATGAAAGTGTTGATTTTGATAGG + Intronic
1080925514 11:36752135-36752157 ATAAAGATATTTATTTTGTATGG - Intergenic
1080926483 11:36761973-36761995 ATGAATATATTCATTTTTGTTGG + Intergenic
1081234507 11:40630899-40630921 ATGAATATATTCATTTTCTCTGG + Intronic
1081405884 11:42697420-42697442 ATTATGATTTCCATTTTGTTAGG + Intergenic
1082185086 11:49169310-49169332 ATGTAGATGTGCATTTTGTGGGG - Intronic
1082252682 11:49999279-49999301 ATGAAAATGTACATTTTTCTAGG + Intergenic
1084818443 11:71665894-71665916 ATGGAGATGTTCAGTTTTTTTGG + Intergenic
1086088703 11:82983387-82983409 ATGAACATGTTCATCATGTGTGG + Intronic
1086256809 11:84886671-84886693 ATGAAGCAGTTCACTTGGTTGGG + Intronic
1086681250 11:89676031-89676053 ATGTAGATGTGCATTTTGTGGGG + Intergenic
1086899331 11:92348827-92348849 AGTAAGATGTGCTTTTTGTTGGG + Intergenic
1087398258 11:97631224-97631246 ATGAAATTGTTCATATTGATTGG - Intergenic
1090817578 11:130312804-130312826 ATGGAGTTGTTAATTTTGATAGG + Intronic
1090891733 11:130929622-130929644 ACGTAGTTGTTCATTTTGCTTGG - Intergenic
1091254239 11:134169699-134169721 TTGAAAATCTTCATTTTGGTAGG - Intronic
1091925905 12:4348722-4348744 ATGATGATGTCTAATTTGTTGGG + Intronic
1091935379 12:4430682-4430704 AAGAAAATGTTCTTTTTGTTAGG + Intronic
1092341648 12:7681615-7681637 ATAAAGATGTTCCTTTTCTTTGG - Intergenic
1093568419 12:20636055-20636077 AAGAAGATATTCATTGTCTTAGG + Intronic
1093631277 12:21412546-21412568 ATGAATTTGTCTATTTTGTTAGG + Intronic
1094336077 12:29355734-29355756 ATTAATTTGTTCATTTTTTTTGG - Intronic
1094629083 12:32154755-32154777 AAGTAGATGTTCATTTTCTTAGG + Intronic
1095043407 12:37470314-37470336 ATGAAGAGGTTAATTTTTTAGGG + Intergenic
1095357207 12:41289536-41289558 ATGAAGATGGTCAATTTCTAAGG + Intronic
1095626026 12:44316558-44316580 TTGATGATGTTCTTTTTGTATGG + Intronic
1095711574 12:45294371-45294393 ATGAAGATGTAAACTTTGTCAGG - Intronic
1095782267 12:46072921-46072943 AGGAAGATGGTCATTTGTTTAGG + Intergenic
1098505210 12:71241431-71241453 ATAGAGATGTTCCTTTTATTGGG + Intronic
1098566577 12:71944015-71944037 ATGATGATGTTCATTTTACAGGG + Intronic
1098609900 12:72443685-72443707 AGGAAGATAGGCATTTTGTTTGG + Intronic
1099119896 12:78675817-78675839 ATAAAAATGTTCACTGTGTTAGG - Intergenic
1099265101 12:80436508-80436530 ATGAAAATGCTCATTTTAGTGGG + Intronic
1099280635 12:80641288-80641310 ATGAAGAAATTTATTATGTTTGG - Intronic
1099357547 12:81657779-81657801 ATTAAGATCTTCATTATGTATGG - Intronic
1099566910 12:84262372-84262394 AGGAAGATGTTCTTTATGTTTGG + Intergenic
1099911057 12:88834170-88834192 TGGAAGATGTTCATTCTTTTTGG + Intergenic
1100703287 12:97172098-97172120 ATGAAGATTCACAGTTTGTTTGG + Intergenic
1102419884 12:112795086-112795108 CTGAAGATGTGCATTTGGTTGGG + Intronic
1104048102 12:125177637-125177659 ATGATTATAGTCATTTTGTTAGG + Intergenic
1105061925 12:133160597-133160619 ATAAAGATGTTCCTGTTGTCAGG + Intronic
1105356500 13:19664230-19664252 ATGGAAATGTTCATTTTGTTTGG + Intronic
1106850110 13:33781133-33781155 TTGAAGATGTTGATACTGTTTGG - Intergenic
1107460259 13:40595068-40595090 ATTAGGATGTTCCTTTTGTGAGG - Intronic
1107554953 13:41509528-41509550 ATTAAGATGTTCATTTTAAGTGG - Intergenic
1107768321 13:43761596-43761618 CAGAAGAATTTCATTTTGTTGGG + Intronic
1108189867 13:47927299-47927321 TTGAAGACGTACAGTTTGTTGGG + Intergenic
1108666062 13:52632400-52632422 ATTAAAATGTTCTTTTTTTTAGG + Intergenic
1108909663 13:55530046-55530068 ATTTAGATTTTCATTTTCTTAGG - Intergenic
1109301577 13:60594913-60594935 CTGAATATGTTCATAGTGTTTGG - Intergenic
1110376421 13:74799622-74799644 ATGAAGAGGTTGGTTGTGTTTGG - Intergenic
1110581210 13:77130016-77130038 GTGAAGATGTTAATTTTTCTAGG - Intronic
1110605602 13:77428406-77428428 ATGAAAATGTTCAAGTTGGTGGG + Intergenic
1111574199 13:90129073-90129095 TTGAAGATTTTCATATTCTTAGG - Intergenic
1112768084 13:102767402-102767424 ATGATGGTGATGATTTTGTTCGG - Exonic
1113315134 13:109171703-109171725 ATAAAGATGTTTATTTTGTGGGG + Intronic
1114748622 14:25178635-25178657 ATGAAGATGTTTATTTTGATTGG + Intergenic
1114915194 14:27255060-27255082 TTTAATATGTTGATTTTGTTGGG + Intergenic
1115462248 14:33674411-33674433 TTGATGATGGTTATTTTGTTTGG - Intronic
1115697943 14:35920754-35920776 GTAAAAATGTTCATTTTTTTAGG + Intronic
1116327656 14:43552415-43552437 AGGAATATGTTCATTTTTATAGG - Intergenic
1118438250 14:65790526-65790548 ATTCAGATGTTGAGTTTGTTTGG - Intergenic
1118739133 14:68725960-68725982 ATGAAGATGGTGGTTGTGTTAGG - Intronic
1119083147 14:71715885-71715907 ATGAACATTATCATTTTATTGGG - Intronic
1120119938 14:80667008-80667030 ATGCAGATGTTTGCTTTGTTTGG - Intronic
1120526618 14:85584202-85584224 ATCAACTTGTTCATTTTGCTAGG - Intronic
1120783865 14:88512280-88512302 ATGAAGATGTTCATTTTGTTGGG - Intronic
1121147486 14:91597323-91597345 ATGAAGGTTTTCACTTTTTTTGG - Intronic
1121423257 14:93830699-93830721 ATGAAGATGTTGATTCCCTTGGG + Intergenic
1122458418 14:101875363-101875385 ATGATGCTGTACATTTTCTTTGG - Intronic
1122610556 14:102979700-102979722 AAGAAGATTTTCCTTTTATTTGG + Intronic
1202941952 14_KI270725v1_random:157925-157947 ATGAAGAGGTTAATTTTTTAGGG + Intergenic
1124546685 15:30634821-30634843 ATAAAGATGTTCAATTTGTGTGG + Intronic
1124780290 15:32624821-32624843 ATAAAGATGTTCAATTTGTGTGG + Intronic
1124915546 15:33968344-33968366 ATGATGATATTCGTTTTGATAGG - Intronic
1125090489 15:35785592-35785614 GTGATGATTTTCAGTTTGTTTGG + Intergenic
1125368378 15:38943239-38943261 AGGGAGATGATGATTTTGTTAGG + Intergenic
1125706690 15:41743652-41743674 ATGCAGATGTTCCTTTTGTGGGG + Intronic
1126050208 15:44678316-44678338 ATGAAGATTTTCATTCTGAAGGG + Intronic
1126291502 15:47085539-47085561 ATGAAGAGGTTAATTTTTTACGG - Intergenic
1126572361 15:50165425-50165447 ATGAACATGTTTCTTTTGTGTGG + Intronic
1126906489 15:53373465-53373487 ATGATCATATTCATTTTGCTTGG - Intergenic
1127210286 15:56767385-56767407 AAGAAAATGTTCATTTTGAAAGG + Intronic
1127575862 15:60291416-60291438 ATGAAGAGACTCATTTTGTTTGG - Intergenic
1131207588 15:90464177-90464199 AGGAGTATGTTAATTTTGTTGGG + Intronic
1131319522 15:91373452-91373474 ATCAAGAAGTTCATGTTCTTTGG - Intergenic
1131760230 15:95614759-95614781 ATGAAGATTTTTACTTTGTTTGG - Intergenic
1131796559 15:96023411-96023433 GGGAAAATGTTCATTTTATTTGG - Intergenic
1132922337 16:2404006-2404028 ATGGCAAAGTTCATTTTGTTTGG - Intergenic
1133099903 16:3472945-3472967 ATGAAGGTGTTAATCTTGTCAGG - Intronic
1133957458 16:10457294-10457316 TTGAAAATGCTAATTTTGTTTGG + Intronic
1134797605 16:17056377-17056399 TTGGAGATCTTCATTTTTTTAGG + Intergenic
1137563624 16:49519509-49519531 CTAATGATGTTCATTTTCTTTGG + Intronic
1137599580 16:49747170-49747192 ATGTAGATGCTAATTTTTTTTGG - Intronic
1137619878 16:49869239-49869261 ATGAAAATGTTACATTTGTTGGG + Intergenic
1137700028 16:50490893-50490915 ATAAATATATTCATATTGTTGGG + Intergenic
1138318153 16:56088104-56088126 TTGGAGATGTTCATTTTGCAGGG + Intergenic
1138616389 16:58170870-58170892 ATGAAGATAGTTATTATGTTAGG - Intronic
1139018361 16:62717765-62717787 ATGAAGAAGATAATTTTGTATGG + Intergenic
1140600486 16:76469907-76469929 AAGAAGATGTATATTTAGTTTGG + Intronic
1140845212 16:78880600-78880622 ATGAAGATGGGCATTTTGGCTGG - Intronic
1141105748 16:81232257-81232279 CTCATGATGTTCTTTTTGTTTGG - Intergenic
1141376496 16:83535702-83535724 ATGATAATGTTCATTTTTTTTGG + Intronic
1141844367 16:86597212-86597234 ATGAAGATGTTACTTTCTTTTGG + Intergenic
1143000469 17:3791600-3791622 ATGAAAATGTCCATGTTTTTTGG + Intronic
1143801669 17:9388005-9388027 ACGAAGTTTTTCATTTTGGTTGG + Intronic
1144501357 17:15788326-15788348 ATCAAGATGTACAATTTTTTGGG - Intergenic
1145163532 17:20591000-20591022 ATCAAGATGTACAATTTTTTGGG - Intergenic
1148396827 17:47314926-47314948 AAGTAGATTTTCATTTTGTGTGG - Intronic
1149101671 17:52913663-52913685 ATGAAGAAGATCATTTTACTTGG + Intergenic
1149518287 17:57297782-57297804 GTGAAGATGTGCACGTTGTTGGG - Intronic
1149923113 17:60677576-60677598 ACGAACATGTACATTTTTTTTGG - Intronic
1150248303 17:63692054-63692076 TTGGAGATGGTCATTTTGTGCGG + Intronic
1150872111 17:68923892-68923914 AACAAAATGTCCATTTTGTTTGG - Intronic
1153012072 18:548280-548302 ATGAAGATGAAGAATTTGTTGGG - Intergenic
1153113221 18:1619549-1619571 ATGACCATATTCATTTTGGTGGG + Intergenic
1153370391 18:4308820-4308842 AAGATGAAGTTCATTTTATTTGG - Intronic
1155402312 18:25452428-25452450 ATACAGGTTTTCATTTTGTTAGG - Intergenic
1155631624 18:27900811-27900833 TTGTTGTTGTTCATTTTGTTTGG + Intergenic
1156242820 18:35270048-35270070 ATGAAGTTGCTAATTTTCTTAGG - Intronic
1156599802 18:38591922-38591944 ATGAATATTTTCATTCTTTTAGG - Intergenic
1157906783 18:51576385-51576407 ATGAAGATGGATATTTGGTTTGG + Intergenic
1158012673 18:52747372-52747394 ATGGAGAAGTTTATTTTGTTTGG - Intronic
1158415481 18:57246478-57246500 ATGAAGATGTTTGGTGTGTTTGG + Intergenic
1160291644 18:77600010-77600032 AACAGGATTTTCATTTTGTTGGG - Intergenic
1160601747 18:80018933-80018955 ATGAAGATGAGGAATTTGTTGGG - Intronic
1166602522 19:44110575-44110597 AAGAAGCTTTTCATTTTGCTAGG + Intergenic
1166625992 19:44356565-44356587 ATACTGATGTTCGTTTTGTTGGG - Intronic
928414611 2:31081578-31081600 GTGCACATGTTTATTTTGTTGGG + Intronic
928701020 2:33898665-33898687 AAGAAGATGTTCATTTCCTAGGG - Intergenic
928991945 2:37242012-37242034 AAGGAGATTTACATTTTGTTTGG - Intronic
929801271 2:45105210-45105232 TGGAAAATGTTCATTTGGTTTGG - Intergenic
930929574 2:56864782-56864804 ATGAAGTTTTCCATTTTGGTTGG + Intergenic
931010038 2:57900340-57900362 AAGGAGATGTTGATTTTTTTGGG - Intergenic
931153799 2:59604777-59604799 CAGAAGATGTTCAGTGTGTTTGG - Intergenic
933231953 2:79818154-79818176 ATTAAGAAGTTCACTTTTTTTGG + Intronic
934939617 2:98490937-98490959 ATTAAAATGTTTATTTTCTTTGG - Intronic
935401698 2:102666948-102666970 ATTAAGATGATCATTTGATTGGG + Intronic
935437034 2:103046192-103046214 TTGACGTTGTTCATTCTGTTGGG - Intergenic
935962571 2:108441652-108441674 ATGAAGATGTACGTTTGGTAAGG - Intergenic
937586886 2:123563284-123563306 ATTAAAATGTTATTTTTGTTGGG + Intergenic
938240062 2:129736437-129736459 ATAAAGACCTTCATTTTGGTGGG + Intergenic
938820412 2:134952352-134952374 ATGAAGATTTTTTTTTTATTGGG + Intronic
938853647 2:135287458-135287480 ATGATGATGGTTATTTTGATGGG + Intronic
939283341 2:140094342-140094364 CTGAAGATGTTGATTTTCTGGGG + Intergenic
939427105 2:142053283-142053305 AAAAATGTGTTCATTTTGTTTGG + Intronic
939702864 2:145416036-145416058 ATGTACATGTTCATTCTGTTAGG + Intergenic
940211523 2:151260583-151260605 ATAAAGATGTAAATTTTGTTTGG + Intronic
940515267 2:154676552-154676574 AAGAGAATGTTGATTTTGTTGGG + Intergenic
940688947 2:156890400-156890422 ATGAACATGTCTATTTTGCTTGG + Intergenic
940727955 2:157356699-157356721 ATGATGATTTTCTTTTTGTCTGG - Intergenic
940754620 2:157667954-157667976 ATAAAGATGGTCATTTCTTTTGG + Intergenic
941420000 2:165272262-165272284 ATAAAAATGGTCATTTTATTGGG + Intronic
942018500 2:171842290-171842312 ATGCAAAAGTTCATATTGTTTGG + Intronic
942191692 2:173476990-173477012 AGTAAGATTTGCATTTTGTTGGG + Intergenic
942279520 2:174345808-174345830 TGGAAGATGTTCATTTTGTTTGG - Intergenic
942282018 2:174375309-174375331 ATTAAAATGTTCATTTTGGCTGG + Intronic
942284540 2:174402263-174402285 ATGAAGGTGTTCATTTTAGATGG - Intronic
942922321 2:181391002-181391024 AAGTAGATGCTCATTTTCTTTGG + Intergenic
942964068 2:181868482-181868504 ATGAAGCTGTTAATTTCTTTTGG + Intergenic
943077435 2:183212485-183212507 ATGAATATGTTGAATATGTTAGG - Intergenic
943162761 2:184276639-184276661 AAGGAGATCTTCATTTTCTTTGG - Intergenic
943194449 2:184726365-184726387 ATGAAAATATTCATTTTTGTAGG + Intronic
943380270 2:187136060-187136082 ATTAATATGTACATTTTGTAGGG - Intergenic
943991966 2:194707642-194707664 ATGTATATGTTCATTTTGGTGGG + Intergenic
944038583 2:195328277-195328299 AAAAAGATTTTTATTTTGTTGGG + Intergenic
944174208 2:196811614-196811636 GTGAAGATCATCATTCTGTTTGG + Intergenic
944665061 2:201952906-201952928 AAGAAAATGTTCATATTTTTGGG - Intergenic
944806733 2:203289722-203289744 TTGAAGATGTTTATTTTGGGAGG - Intronic
945007348 2:205422916-205422938 ATGAGGATGTTTCATTTGTTAGG - Intronic
947193091 2:227530539-227530561 ATGAATATCTTCAATTTATTTGG + Intronic
948606643 2:239139919-239139941 ATGGCCATGTTCTTTTTGTTGGG - Intronic
1169539990 20:6589333-6589355 AAGATGATGTTCTTTTTCTTAGG + Intergenic
1169627616 20:7589988-7590010 ATGAAGATGTAAAATTTCTTTGG - Intergenic
1171803323 20:29648732-29648754 ATGAAGAGGTTAATTTTTTAGGG - Intergenic
1173653540 20:44683121-44683143 ATGAAGCTAGTCATTGTGTTGGG - Intergenic
1174498706 20:50968347-50968369 ATCATGATATTCTTTTTGTTTGG - Intergenic
1174512898 20:51068436-51068458 ATGAATATTTTCATTTTCTATGG - Intergenic
1175109462 20:56636610-56636632 GTGAAGCTGTTCATTTGGCTAGG + Exonic
1175481657 20:59315482-59315504 ATGAACATGTTCTATTTGTTGGG + Intronic
1175792328 20:61747621-61747643 ATTGAGCTCTTCATTTTGTTTGG - Intronic
1176581216 21:8529009-8529031 ATGAAGAGGTTAATTTTTTAGGG - Intergenic
1176875858 21:14126897-14126919 ATGAAAATGTAAATTTTGATTGG + Intronic
1177265950 21:18783927-18783949 TTGAAGATGATAATTTGGTTAGG + Intergenic
1178559690 21:33627000-33627022 ATGAAGATGTTCATTAATATTGG + Intronic
1178943878 21:36930084-36930106 GTGCAAATATTCATTTTGTTGGG - Intronic
1178949899 21:36977718-36977740 CTGAATGTGTGCATTTTGTTGGG - Intronic
1181940510 22:26472289-26472311 ATGAAAATGTTACTTTAGTTTGG + Exonic
951237931 3:20256571-20256593 TTCATGATGTTCATTTTGTATGG + Intergenic
951271252 3:20627015-20627037 AGGAATTTGTTCATTTTGTCTGG + Intergenic
951970091 3:28434184-28434206 AAGAAGTTATTCATTTTATTTGG - Intronic
952241816 3:31538500-31538522 ATGTTGATGTTGGTTTTGTTAGG + Intronic
953016656 3:39083300-39083322 AGGAAGCTTTTGATTTTGTTTGG + Intronic
953287415 3:41625836-41625858 AAAAAGGTCTTCATTTTGTTTGG - Intronic
953650606 3:44799731-44799753 ATGAAGATAATCATTTAGTGTGG + Intronic
954938226 3:54346432-54346454 ATGTAGATGTTAATTGTATTTGG + Intronic
955177831 3:56634633-56634655 ATAAATATTTTCCTTTTGTTTGG + Intronic
955354584 3:58220432-58220454 ATTAAGAAGTACATTTTGTAAGG + Intergenic
955426921 3:58800901-58800923 ATGAAGATTTTCATTTTCCATGG + Intronic
955667060 3:61361269-61361291 ATTTAGATGTTCATTCTTTTGGG - Intergenic
956310913 3:67879311-67879333 ATGAAGATGTTTTGTTTGTTTGG + Intergenic
956561683 3:70584092-70584114 ATGAATATCTTCATACTGTTAGG + Intergenic
956881570 3:73516271-73516293 ATTAAAATGTTCATTCTGTCTGG - Intronic
957478235 3:80755387-80755409 AAGAAGATGTTTATTTCATTGGG - Intergenic
958146390 3:89630657-89630679 ATGAAGATGAGGAATTTGTTGGG + Intergenic
958501196 3:94911157-94911179 ATGAAGATGAGCACTTTGTGGGG + Intergenic
958903736 3:99919132-99919154 ATTAAGATTTTCAGTTTCTTTGG - Intronic
959420534 3:106122708-106122730 ATGAGTATTTACATTTTGTTTGG - Intergenic
959550387 3:107649276-107649298 ATGCAGATGTTGATATAGTTTGG - Intronic
960825068 3:121773901-121773923 TTGATGAAGTTCATTTTGTCTGG - Intronic
960828916 3:121823427-121823449 TTTAAGATGTTCTCTTTGTTTGG - Intronic
962083807 3:132169240-132169262 ATAAAAATATTGATTTTGTTAGG - Intronic
962369883 3:134812605-134812627 AAATAGGTGTTCATTTTGTTTGG + Intronic
963210891 3:142688642-142688664 ATGAAGAATTTAATTTTGTAAGG - Intronic
963524305 3:146396955-146396977 ATGAATATGTTCTGTTTGTAGGG - Intronic
963569904 3:146980499-146980521 ATATAGCTGTTCATTTTGTGTGG - Intergenic
964505236 3:157391753-157391775 TTGGTGATGTTCATTTTGTATGG - Intronic
965188003 3:165489945-165489967 ATGAAGATGTGAATATTCTTTGG - Intergenic
966132131 3:176653013-176653035 AGGAAGATGTTGATTTTTTTAGG - Intergenic
969905803 4:10394805-10394827 TTGGTGATGTTCATTTTGTATGG + Intergenic
970158589 4:13166661-13166683 ATGAAGGTGTTTATTTGGTTCGG - Intergenic
970335839 4:15041280-15041302 ATCATGATGTTTATATTGTTAGG + Intronic
970367973 4:15380068-15380090 GGAAAGATATTCATTTTGTTGGG - Intronic
970941671 4:21641438-21641460 ATCTAGTTGTTCACTTTGTTTGG + Intronic
971226735 4:24760957-24760979 ATGAGATTATTCATTTTGTTTGG + Intergenic
971415665 4:26426208-26426230 AGGATGATGTTCATTTGCTTTGG + Intronic
971456435 4:26849736-26849758 ATGAAGATCCTCTTGTTGTTGGG + Intergenic
972555097 4:40173509-40173531 AGGAAGAAGTTCATTTTGACTGG + Intergenic
972857675 4:43126897-43126919 ATGAAGATGATGATTTAGTAAGG + Intergenic
972892148 4:43570921-43570943 ATGTATATGTTCATTTTGTGTGG - Intergenic
973256949 4:48123345-48123367 AGGAAGATGATAATTCTGTTGGG - Intronic
973706562 4:53587047-53587069 CTGAAGGTGATCATTTTTTTTGG - Intronic
974493190 4:62593190-62593212 ATGAAGATGAATATTTTGCTTGG + Intergenic
974655671 4:64817239-64817261 ATGTAAATGATCATTTTGTGAGG - Intergenic
975054572 4:69913681-69913703 AAAAAGATTTTCATATTGTTGGG + Intergenic
975217810 4:71776839-71776861 ATTAAGACGTGTATTTTGTTAGG - Intronic
975230827 4:71930786-71930808 AAGTAGATGTTCATTTTGTATGG + Intergenic
975884359 4:78946596-78946618 CTGAATATGTTCTTTTTGTTAGG + Intergenic
976386631 4:84467187-84467209 ATTCTGAAGTTCATTTTGTTAGG + Intergenic
977100880 4:92813505-92813527 ATGAATATTTTGATTTTGGTAGG - Intronic
977864970 4:102014243-102014265 GAGAAGATGTACATTTTGATAGG - Intronic
978035462 4:103987114-103987136 ATGAAAATCTTCCATTTGTTGGG + Intergenic
978568266 4:110108307-110108329 ATGAAGATATTCATTTAACTTGG - Intronic
978704328 4:111688233-111688255 ATCAGGATGGTTATTTTGTTTGG - Intergenic
978716001 4:111843120-111843142 ATGATGTTATTCATTTTATTGGG - Intergenic
978986160 4:115015416-115015438 ATCTAGTTGTTCATTTTGTTTGG + Intronic
979172244 4:117615806-117615828 ATTAAGATGATCTTCTTGTTTGG - Intergenic
980299068 4:130964694-130964716 ATGGAGATGAGGATTTTGTTAGG + Intergenic
980684109 4:136203112-136203134 ATGATGGAGTACATTTTGTTGGG - Intergenic
981987594 4:150876376-150876398 GTGGTGATGTTCATTTTGTATGG - Intronic
982212467 4:153050016-153050038 ATGAAAATATTCTTTTTGGTTGG + Intergenic
982321568 4:154082441-154082463 ATGAAGATGTGGATAATGTTAGG - Intergenic
982697023 4:158613880-158613902 TTTAAGATGTACATTTTGTAAGG - Intronic
983921549 4:173351050-173351072 ATTAAGATGTTGATATGGTTTGG - Intergenic
984463599 4:180069496-180069518 AAGAAAATTTTCTTTTTGTTTGG + Intergenic
984717718 4:182941185-182941207 ATGGAGATGTTCTTGTTCTTAGG + Intergenic
986118061 5:4800158-4800180 ATGAAAATGCTCATTTGGGTTGG + Intergenic
986506114 5:8453668-8453690 ATGAAAACCTGCATTTTGTTTGG - Intergenic
987024262 5:13908279-13908301 ATGTAGATGTTTATTTAGGTAGG - Intronic
987727202 5:21717655-21717677 ATGAAGATGAGGAATTTGTTCGG - Intergenic
988127558 5:27061024-27061046 ATGAAGATGTATTTTATGTTGGG + Intronic
988329915 5:29823013-29823035 ATTATGTTGTTCATTGTGTTAGG - Intergenic
988361730 5:30244688-30244710 ATAAAGATGTTTATTATATTTGG - Intergenic
988386992 5:30577379-30577401 ATGATGATAGTCATCTTGTTGGG - Intergenic
988926767 5:35998082-35998104 ATCAGGTTGTTCATTTTTTTAGG - Intergenic
989975319 5:50578940-50578962 AGGAAAAAATTCATTTTGTTTGG - Intergenic
990321483 5:54633876-54633898 ATGGAGCTATTCATCTTGTTGGG + Intergenic
990332761 5:54743932-54743954 ATGAAGAGGCTCATTTTCCTTGG - Intergenic
990342957 5:54842479-54842501 ATGAAGGTTGTCATATTGTTCGG + Intergenic
990711108 5:58581991-58582013 ATGAATGTGTTCATTTTATGTGG + Intergenic
991023413 5:62004780-62004802 ATGTTGAATTTCATTTTGTTGGG - Intergenic
992220971 5:74573053-74573075 ATAAAGATGTTCTTTTTCTCTGG - Intergenic
993356905 5:86924617-86924639 ATGACAATGTTAAGTTTGTTTGG - Intergenic
994072251 5:95615827-95615849 CTGATGATGCTCATATTGTTGGG + Intergenic
995876798 5:116798798-116798820 ATGCTGATGTTCATTATGATGGG + Intergenic
998029094 5:138848701-138848723 ATTAAAATGTGCATTTTGATTGG + Intronic
998554932 5:143114177-143114199 AGGAAGATGTTAAATGTGTTTGG + Intronic
998742431 5:145219800-145219822 ATGAAGAAGTTGATTTCATTAGG + Intergenic
999390946 5:151189843-151189865 ATGTTGATGTTCATAATGTTGGG + Intronic
999391045 5:151190894-151190916 ATGTTGATGTTCATAATGTTGGG - Intronic
999552053 5:152699981-152700003 AGGTAGAAGTTCATCTTGTTAGG - Intergenic
999912608 5:156220907-156220929 ATGGGCATGTTCATTTTGTGTGG + Intronic
1000592715 5:163177795-163177817 AGGACAAAGTTCATTTTGTTTGG + Intergenic
1001672910 5:173489131-173489153 ATGTAAATGTTCATTTTTCTGGG + Intergenic
1002797830 6:489651-489673 ATGATGCTTTTCATTTGGTTTGG - Intronic
1003433236 6:6059853-6059875 AAGAAAATGTTAATTTTGTTAGG - Intergenic
1004837532 6:19544743-19544765 ATAAAGATGTTTATTTTGCCTGG - Intergenic
1005194627 6:23268759-23268781 ATAACGATGTGCTTTTTGTTTGG - Intergenic
1007302407 6:40877275-40877297 AGGAAAATACTCATTTTGTTTGG + Intergenic
1009042781 6:58200264-58200286 ATGCACATGTTCAGTTTGTGGGG + Intergenic
1009476918 6:64104056-64104078 ATGTACATTTTGATTTTGTTGGG + Intronic
1009786487 6:68346991-68347013 ATGAAGTTGATCATTTGATTAGG + Intergenic
1010882232 6:81191966-81191988 ATGATGATTTTAATTATGTTGGG + Intergenic
1012029936 6:94046060-94046082 CTTAAGAGGTTCATTTTGTGTGG + Intergenic
1012309414 6:97703257-97703279 TTATAGATGTTCATTTTGATAGG + Intergenic
1013006271 6:106077070-106077092 ATTAAGATGTTCATGTTTATGGG - Intergenic
1014378623 6:120710928-120710950 ATGAAGGTGCTTATTTTGTGTGG - Intergenic
1015023881 6:128509551-128509573 ATAAAAATGTAAATTTTGTTAGG - Intronic
1015337101 6:132052128-132052150 TTTAAGATATTCATTTTGTAAGG + Intergenic
1015401897 6:132796778-132796800 AAGAAGATGTTCTTTTTGACTGG + Intronic
1015505508 6:133982388-133982410 ATTAATATGTTCTTTGTGTTTGG + Intronic
1016337778 6:143026321-143026343 ATTAAAATGTGCTTTTTGTTAGG - Intergenic
1017539738 6:155388315-155388337 ATGATGATGTTCCTTTCCTTAGG + Intergenic
1017541811 6:155410647-155410669 ATGAAGATGATCTTTTGTTTTGG - Intronic
1017790640 6:157795503-157795525 ATTATGTTGTTAATTTTGTTAGG + Intronic
1017838926 6:158205557-158205579 ATGATGATATTCTTTTTGTAAGG - Intergenic
1018051138 6:160009259-160009281 ATGATGATGGTCATTTGGTAGGG - Intronic
1018211061 6:161481990-161482012 ATAAATATGTTCATTTTGCGGGG + Intronic
1018410452 6:163540097-163540119 ATGAATAAGTTCTTTTTTTTTGG + Intronic
1020862120 7:13506671-13506693 ATCAAAATGTTAATTTAGTTTGG - Intergenic
1022571116 7:31455175-31455197 ATTACGATGTTCAGTTGGTTAGG - Intergenic
1022951051 7:35338315-35338337 ATGAACATTTTAATTATGTTCGG + Intergenic
1023162912 7:37314775-37314797 ATGATGATGTTTTCTTTGTTCGG - Intronic
1023900427 7:44473277-44473299 ATGCTGATGTTCATATTGTTTGG - Intronic
1024454612 7:49589525-49589547 ATGAAGATATTTATTCTTTTAGG + Intergenic
1024546289 7:50523086-50523108 ATGTAGATGTTGATATGGTTTGG - Intronic
1025145763 7:56501704-56501726 TTGAAGATGTTAATTTTATAAGG + Intergenic
1025190925 7:56895256-56895278 AGTAAAATGTTCATTTGGTTGGG + Intergenic
1025681018 7:63681673-63681695 AGTAAAATGTTCATTTGGTTGGG - Intergenic
1025710908 7:63908392-63908414 TTGAAGATGTTAATTTTATAAGG + Intergenic
1025740245 7:64190099-64190121 TTGAAGATGTTAATTTTATAAGG + Intronic
1027221413 7:76216614-76216636 GAGAAGAGGTTCATTTTGGTGGG + Intronic
1027468638 7:78546031-78546053 ATAAAGATGTTCATGTATTTGGG + Intronic
1027742692 7:82031736-82031758 ATGAATATGTTCAGATGGTTTGG - Intronic
1027930808 7:84532362-84532384 AACAAGATGGTTATTTTGTTTGG - Intergenic
1028389576 7:90299553-90299575 GTGAAGATGTTCATTTTAAGTGG - Intronic
1028568986 7:92265619-92265641 ATGAAGCTGTTGAAGTTGTTAGG + Intronic
1030383078 7:108835462-108835484 AAGAAAATGTTCATTTAGATTGG + Intergenic
1030789993 7:113713118-113713140 ATTAACATTTACATTTTGTTTGG + Intergenic
1030814888 7:114023600-114023622 ATTAAGATATTGATTTTGTGGGG + Intronic
1031759279 7:125690934-125690956 ATGAAGATTTCCATTCTGGTTGG - Intergenic
1033060487 7:138101613-138101635 ATAAAGATTTTAATTTTTTTAGG - Intronic
1033497501 7:141914184-141914206 ATCAAGATGTCCATTATGGTCGG + Intronic
1033812547 7:145033128-145033150 GTTAGGATGTTCACTTTGTTAGG + Intergenic
1034719474 7:153276562-153276584 ATACAGATGTTCATCTTATTGGG - Intergenic
1035717659 8:1766217-1766239 CTGCAGATCTTCATTTTCTTTGG - Intronic
1036108241 8:5866331-5866353 ATGAAAGTGATTATTTTGTTTGG + Intergenic
1037594416 8:20342989-20343011 TTGAAGATGTTCCCTTTTTTTGG + Intergenic
1038811681 8:30852733-30852755 TTGAAGATGTTGGATTTGTTGGG - Intronic
1039051040 8:33493957-33493979 ATTAAAATGTTGCTTTTGTTTGG + Intronic
1039408733 8:37334330-37334352 AAGACGCTGTTCATTTTTTTTGG - Intergenic
1039636538 8:39173284-39173306 AGGAATATGTTTGTTTTGTTTGG - Intronic
1039866269 8:41506055-41506077 AAGAAAATGTTGATATTGTTTGG + Intronic
1040878419 8:52176893-52176915 TTGAATATGTACATTTTGCTGGG + Intronic
1041133414 8:54728740-54728762 ATTATGATATTAATTTTGTTAGG + Intergenic
1041254675 8:55969642-55969664 ATGATGATGTGAATTTTGTTTGG + Intronic
1041291941 8:56316301-56316323 AAGAAACTGTTCATTTTCTTAGG - Exonic
1041470326 8:58200997-58201019 ACAAAGTTGTTCAGTTTGTTAGG - Intronic
1042153803 8:65819433-65819455 ATTAAAATGTTCAAATTGTTTGG + Intronic
1042278857 8:67033350-67033372 CTGAAGATGATCATTTCATTGGG + Intronic
1042571447 8:70169882-70169904 ATGATGATGATGATTTTGCTTGG - Intronic
1043277160 8:78412823-78412845 ATGAATATATCCATATTGTTTGG - Intergenic
1043826459 8:84935188-84935210 AGAAAGATGCTCTTTTTGTTAGG - Intergenic
1044151378 8:88780117-88780139 AACAAGATGATCATCTTGTTGGG + Intergenic
1044362124 8:91298792-91298814 ATCTGGATTTTCATTTTGTTAGG + Intronic
1044994311 8:97824151-97824173 ATGTATATTTTCATTTTATTCGG + Intronic
1045421054 8:102015600-102015622 ATGAAGCTTTTCTTGTTGTTAGG - Intronic
1045716671 8:105055182-105055204 ATGAATATGTACATATTGATGGG - Intronic
1045984438 8:108233348-108233370 ATTAAAATTTTCATTTTGTGGGG - Intronic
1046041002 8:108904655-108904677 AAGAAGATGTGCATTTAATTTGG + Intergenic
1046132525 8:109984741-109984763 ATGAATATTTACATATTGTTAGG + Intergenic
1046820695 8:118631359-118631381 ATGAAGAAGTCCATGTTGTGGGG - Intergenic
1047066610 8:121291462-121291484 ATGAATATGATCATTTTGTGTGG + Intergenic
1049942123 9:556973-556995 AAGAAATTGTTAATTTTGTTAGG + Intronic
1050836209 9:10082098-10082120 ATGAAGAGGTTCATTTTGTATGG - Intronic
1051216853 9:14806970-14806992 TGGGAGATGTTCATTTTCTTTGG + Intronic
1052379213 9:27751862-27751884 ATGAAAATTGTCATTCTGTTTGG + Intergenic
1052471791 9:28906723-28906745 TTTAAGATGGTCACTTTGTTAGG - Intergenic
1052591731 9:30504959-30504981 AAAAAGATGTTCATTTTGTTTGG + Intergenic
1052876141 9:33566274-33566296 ATGAAGAACTTCATTGTCTTTGG - Exonic
1053499873 9:38578071-38578093 ATGAAGAACTTCATTGTCTTTGG + Intergenic
1054712359 9:68523965-68523987 AGTAAGAAGTTCAGTTTGTTAGG + Intronic
1054798226 9:69322518-69322540 GTGAATATGTTCATTTCTTTTGG + Intergenic
1054989162 9:71301671-71301693 ATGAAGATGATTTTTGTGTTTGG + Intronic
1056805885 9:89728712-89728734 ATGAAGATGATGACTTTTTTAGG - Intergenic
1056903908 9:90628110-90628132 ATGAAGGTGTGCATTTTAATTGG - Intronic
1056953479 9:91064391-91064413 ATGAAAATGTTCAGTATGTTTGG - Intergenic
1057578395 9:96262643-96262665 ATGAATATTTTCCTTTTATTAGG + Intronic
1057679297 9:97162769-97162791 ATGAAGAACTTCATTGTCTTTGG + Intergenic
1059825253 9:118020912-118020934 ATGATGACTTTCATTTTATTGGG + Intergenic
1060572777 9:124658184-124658206 TTGAAGGTGTTGCTTTTGTTTGG - Intronic
1060605221 9:124908103-124908125 ATATAGATGCTCTTTTTGTTGGG - Intronic
1203611234 Un_KI270749v1:7054-7076 ATGAAGAGGTTAATTTTTTAGGG - Intergenic
1186020952 X:5254596-5254618 ATGAAGAGCTTCAATTTGTTTGG + Intergenic
1186596354 X:10985940-10985962 ATGAAGTTGTGCATGTTGTGAGG + Intergenic
1186615574 X:11183684-11183706 CTGTAGATCTTCATATTGTTTGG + Intronic
1187416546 X:19098060-19098082 ATTAAGATGCTCATTTTGGCAGG + Intronic
1188815515 X:34707942-34707964 AGGAAGATATTTAATTTGTTAGG + Intergenic
1189422044 X:40864717-40864739 ATTTGGTTGTTCATTTTGTTGGG + Intergenic
1190073366 X:47297188-47297210 ATGTAAATGTTCATTTTTCTGGG + Intergenic
1190843126 X:54165152-54165174 AAGAAATTGTTAATTTTGTTGGG - Intronic
1192137476 X:68617213-68617235 ATGTAAATGTTCATTTTTCTGGG + Intergenic
1192378553 X:70589473-70589495 AAGAAGAAATTCATTTTTTTTGG + Intronic
1192423618 X:71055981-71056003 ATGTACATTTTAATTTTGTTAGG - Intergenic
1193479455 X:82010009-82010031 ATGCCTATGTTCCTTTTGTTGGG + Intergenic
1193858217 X:86632263-86632285 ATGAAGTTTTCCATTTTGTGTGG + Intronic
1193918373 X:87395947-87395969 ATGAAGATGTTCCATTAGCTGGG + Intergenic
1193947670 X:87758320-87758342 AGGAGAATGTTCATTTTTTTTGG + Intergenic
1194167798 X:90541890-90541912 TTTAAGATGTACATTTTGTAAGG - Intergenic
1194172787 X:90608418-90608440 CTGAAGATGTTCAAGTGGTTTGG + Intergenic
1194709972 X:97224027-97224049 ATGATGCTGTTTAATTTGTTTGG + Intronic
1194897714 X:99466505-99466527 ATGAATATCTTTATTTTGTCAGG + Intergenic
1195530786 X:105954338-105954360 ATGAAGATTTTTATTTAATTGGG + Intronic
1195565284 X:106333035-106333057 ATAAAGATGTTCCTTTTCTCTGG + Intergenic
1195926307 X:110029180-110029202 ATGAGGGTGTTAATTTTGTTTGG - Intronic
1196041916 X:111214052-111214074 AGGAAGATGTTCATTTCGTAGGG + Intronic
1196926042 X:120634425-120634447 ATTAAGATGTTCATACTTTTTGG + Intergenic
1197346659 X:125332268-125332290 ATCCAGATGTTCTGTTTGTTTGG - Intergenic
1198323049 X:135538671-135538693 ATTAAGAAGTACATTTTGTAGGG - Intronic
1199399476 X:147380446-147380468 ATGAAAATGTTACATTTGTTGGG - Intergenic
1199823386 X:151472988-151473010 ATTAAGATGTGCATTTTACTTGG + Intergenic
1200519014 Y:4186137-4186159 CTGAAGATGTTCAAGTGGTTTGG + Intergenic