ID: 1120787856

View in Genome Browser
Species Human (GRCh38)
Location 14:88553276-88553298
Sequence TCTTATGGATAGATCTTGGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 131
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 122}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120787856 Original CRISPR TCTTATGGATAGATCTTGGG GGG (reversed) Intronic
900811089 1:4801846-4801868 TCTTATGGTGTGATCTGGGGAGG + Intergenic
905052378 1:35062806-35062828 TCTTACTGACAGATCTTGGGAGG - Intronic
909475139 1:76073817-76073839 TCTTTTGGGTAGATATTTGGGGG + Intergenic
917490595 1:175494826-175494848 TCTAAGGGATAGATTTTTGGAGG + Intronic
918509639 1:185297019-185297041 TCATATGGATAAATATTGGTTGG - Exonic
923861115 1:237892911-237892933 GCTTATGGCCAGATTTTGGGGGG + Intergenic
924374074 1:243387630-243387652 TATGATGGATAGATCATGTGGGG + Intronic
1063858344 10:10280885-10280907 TCTTAAAAAAAGATCTTGGGAGG + Intergenic
1065085592 10:22172453-22172475 GCTTAAGGATAGATGGTGGGAGG - Intergenic
1067940123 10:50648161-50648183 TTTTATGGGTAGGACTTGGGTGG - Intergenic
1068045213 10:51877633-51877655 TATTATGGAAAGATGTTCGGTGG - Intronic
1071198282 10:83187223-83187245 GTTTATGGACAGATTTTGGGGGG + Intergenic
1071880172 10:89888651-89888673 TCTTATGGATAACTTGTGGGGGG - Intergenic
1074980495 10:118615706-118615728 GTTTATGGCTAGATTTTGGGGGG + Intergenic
1075054011 10:119205036-119205058 GCATTTGGATAGATCTGGGGTGG - Intergenic
1079049427 11:17140305-17140327 TCTTTTGGATGGATTTTAGGGGG - Intronic
1082301159 11:50508453-50508475 GCTTATGGCCAGATATTGGGGGG - Intergenic
1082803992 11:57435374-57435396 GCTTATGTAAATATCTTGGGTGG - Intergenic
1086872994 11:92062041-92062063 CCTTATGCATAGACCATGGGTGG - Intergenic
1087500488 11:98945553-98945575 GCTTATGGCCAGATTTTGGGGGG + Intergenic
1088491828 11:110396232-110396254 GTTTATGGCCAGATCTTGGGGGG - Intergenic
1088776030 11:113084078-113084100 TATCATGGAAAGATCTTGGTAGG + Intronic
1091945403 12:4536530-4536552 TCTTAGGGAGAGTTCATGGGTGG + Intronic
1097236903 12:57546702-57546724 TCTTATGGAGAGATTTGGGGGGG + Intronic
1099008761 12:77265854-77265876 TCATATGGATAGATATTGGGGGG - Intergenic
1099502039 12:83425958-83425980 TCTTATGTGTAGATCTCGGATGG - Intergenic
1099694879 12:86005665-86005687 TCTGATGGCTAGTTCTTGGCTGG + Intronic
1100622914 12:96297812-96297834 TCTTAAGTTTAGGTCTTGGGCGG + Intronic
1101714140 12:107295789-107295811 TCTTAAAGATAGATGTTGGCTGG - Intergenic
1102220841 12:111193449-111193471 CCTCATGGATAGCTGTTGGGGGG + Intronic
1105601540 13:21892592-21892614 GCTAATGGAGAGATCTTGGTTGG + Intergenic
1106412319 13:29519201-29519223 TTTTATGGCTAAATGTTGGGTGG - Intronic
1108602353 13:52005832-52005854 GTTTATGGCTAGATTTTGGGGGG - Intronic
1108989068 13:56632201-56632223 TCTCCTGGTTAAATCTTGGGAGG - Intergenic
1111447907 13:88374049-88374071 TTTTATGGCCAGATTTTGGGTGG - Intergenic
1112365274 13:98751049-98751071 TCTTAAGAACAGATCTTGGCCGG - Intronic
1113253226 13:108477401-108477423 TATGATGGATTGATCTAGGGAGG + Intergenic
1116406895 14:44577753-44577775 TCTTGTGGATAGAACTTGAGTGG - Intergenic
1120787856 14:88553276-88553298 TCTTATGGATAGATCTTGGGGGG - Intronic
1123744473 15:23308262-23308284 TCTTTTGGATTTATCTTGTGTGG + Intergenic
1125176602 15:36829803-36829825 ACTTTTGGATAGATCAAGGGAGG + Intergenic
1125178137 15:36849371-36849393 TCTTCCTGATAAATCTTGGGAGG + Intergenic
1126186377 15:45834425-45834447 TCTTATAGATAGGTCCAGGGTGG + Intergenic
1131377328 15:91936494-91936516 TCTTATGGATAGCTCTGGCCTGG + Intronic
1133044232 16:3077313-3077335 GTTTATGGCCAGATCTTGGGGGG + Intronic
1135200388 16:20432105-20432127 TCTTTTGTATTCATCTTGGGTGG + Intronic
1140432093 16:74913054-74913076 GTTTATGGCTAGATTTTGGGGGG + Intronic
1142475385 17:185844-185866 GTTTATGGCTAGATTTTGGGGGG - Intergenic
1146006140 17:29161949-29161971 CCTTAGGGAAAGTTCTTGGGGGG - Intronic
1146936492 17:36815508-36815530 TCTTAGAGATTGATCTTAGGTGG + Intergenic
1162800734 19:13109290-13109312 TCTCATGCATAGAACTTGCGAGG - Intronic
1164251212 19:23477332-23477354 GTTTATGGACAGATTTTGGGGGG + Intergenic
1164262165 19:23577283-23577305 GCTTATGGCCAGATTTTGGGGGG + Intronic
928697806 2:33867784-33867806 ACTAATGGGTAGATCTTGGCAGG - Intergenic
937880979 2:126864453-126864475 TCCTATGGATGGATGTTTGGGGG - Intergenic
939189922 2:138904412-138904434 TCTTATGGTTAGATTTTGTGTGG + Intergenic
939392722 2:141589752-141589774 TCATATGGCTAAATCCTGGGAGG + Intronic
940468131 2:154058896-154058918 TATTATGAATAGATGTTAGGAGG + Intronic
941297487 2:163758343-163758365 AATTATGCATTGATCTTGGGAGG + Intergenic
1170532831 20:17311641-17311663 TATTATGGATAGATCAGGGCTGG + Intronic
1171228948 20:23466938-23466960 GTTTATGGACAGATTTTGGGGGG - Intergenic
1178598206 21:33973626-33973648 TCTTGTGGCTGGACCTTGGGAGG - Intergenic
953889379 3:46740340-46740362 CCTGATGGGTAGTTCTTGGGAGG - Intronic
956267058 3:67408514-67408536 TCTTATGGAGAGATCCTCTGGGG + Intronic
958834625 3:99130265-99130287 ACTTAAGAATAGATTTTGGGGGG - Intergenic
959795270 3:110419874-110419896 TTTTATGGTTGGATCTTTGGTGG + Intergenic
962687657 3:137862996-137863018 TTTTATGGATACAGGTTGGGGGG - Intergenic
964139552 3:153381356-153381378 TCTGATGGGTAGATATTGGCAGG + Intergenic
964142256 3:153417389-153417411 TTTTATGGTTCAATCTTGGGAGG + Intergenic
966272952 3:178130596-178130618 GTTTATGGCTAGATTTTGGGAGG + Intergenic
966533493 3:181006096-181006118 TCTCATGGAAAGATCTTCAGTGG + Intergenic
967603028 3:191412163-191412185 TCTGATTAATAGATCTGGGGTGG + Intergenic
971016362 4:22493338-22493360 TCTTTTTGAAAGATCTTTGGAGG - Intronic
973959556 4:56096167-56096189 TCTTAGGGAGAGATCTGGGCTGG + Intergenic
976264040 4:83173486-83173508 GCTTATGGCCAGATTTTGGGGGG + Intergenic
977006766 4:91576638-91576660 TTTTATGGATATGTCTTGGGAGG + Intronic
977286712 4:95116945-95116967 TCTAATGTATACTTCTTGGGAGG - Intronic
977652076 4:99482012-99482034 TCTTCTGGTTCAATCTTGGGAGG + Intergenic
978633004 4:110768812-110768834 TCTTTTGAAGAAATCTTGGGAGG - Intergenic
980882694 4:138728908-138728930 TCTTATGCATTGACCTAGGGTGG + Intergenic
983703301 4:170625143-170625165 CCTTAGGAATAAATCTTGGGAGG - Intergenic
988992808 5:36688196-36688218 TCTTATGGAAAGGTCCTGTGGGG + Exonic
989742865 5:44793032-44793054 GTTTATGGCCAGATCTTGGGGGG - Intergenic
992170793 5:74099882-74099904 TGTTATGGTTAGAGCTGGGGTGG - Intergenic
993945753 5:94115540-94115562 TGTCATGGATGGATTTTGGGAGG - Intergenic
995100477 5:108295556-108295578 TCTTAAGGATAGTGCTTGGCAGG - Intronic
996412995 5:123179395-123179417 TCTAATGGATAAATATTTGGAGG + Intronic
996809097 5:127494417-127494439 GCCTATGTATAGATTTTGGGGGG - Intergenic
1004756155 6:18612792-18612814 TCTTATGGATGGAGCATGTGAGG + Intergenic
1007542402 6:42660194-42660216 TCTTATTGATAGAGCCTGAGTGG + Intronic
1009627961 6:66161036-66161058 TTTTATGGATACAGCATGGGGGG + Intergenic
1012376967 6:98573914-98573936 TTTTATGGTTAGGTCTGGGGAGG - Intergenic
1013077555 6:106784676-106784698 TCCTATGGTTAGATGGTGGGGGG + Intergenic
1013924650 6:115455800-115455822 TTTTATAGATAGATCCTGGATGG - Intergenic
1014271777 6:119344624-119344646 TTTTATGGGTAGTTCTGGGGTGG - Intronic
1014719657 6:124900625-124900647 GTTTATGGCTAGATTTTGGGGGG + Intergenic
1017557521 6:155587894-155587916 TTCTATGTATAGATTTTGGGGGG - Intergenic
1018006635 6:159628386-159628408 TATTATGGATAAATCTTTTGGGG - Intergenic
1020855003 7:13408538-13408560 TCTTATAGATAGATTTGGGCAGG - Intergenic
1020900629 7:13998889-13998911 TCTTATGGATAGATCTCAGTGGG - Intergenic
1022654172 7:32303869-32303891 TGTTATGGGGAGATCTTTGGGGG - Intergenic
1023242917 7:38168036-38168058 GCTTATGGCCAGATTTTGGGGGG + Intergenic
1030655449 7:112162462-112162484 TTTTGTGTATAGATGTTGGGAGG + Intronic
1030717236 7:112823670-112823692 TCTTGGGGAAATATCTTGGGTGG + Intronic
1032986574 7:137343952-137343974 TCTGAAGAATAGATCATGGGTGG - Intergenic
1033508117 7:142026358-142026380 TCTTAGGGTTAATTCTTGGGAGG + Intronic
1034403919 7:150888588-150888610 GCTTATGGCCAGATTTTGGGGGG + Intergenic
1035143057 7:156783473-156783495 TCTTATTGAAAGATGTTGGTTGG - Intronic
1040529622 8:48256051-48256073 GCTTATGGCCAGATTTTGGGGGG - Intergenic
1041511323 8:58658211-58658233 TCTTGTGGAAAGAGCTTGAGTGG - Intronic
1043243390 8:77965744-77965766 TCTTATGTGTAGACCTTGGATGG - Intergenic
1044496730 8:92896076-92896098 TCTTCTGGATCTATTTTGGGAGG - Intronic
1045809105 8:106200843-106200865 TCTCATGCATAGATCTGAGGTGG - Intergenic
1046123919 8:109880831-109880853 TTTTCTGGAAAGATCTTGGTAGG - Intergenic
1046918673 8:119703990-119704012 TCTGGTGGATAGATAATGGGGGG - Intergenic
1050129198 9:2392748-2392770 GCTTATGGCCAGATTTTGGGGGG - Intergenic
1050397966 9:5220259-5220281 GCTTATGGCCAGATTTTGGGAGG - Intergenic
1051978479 9:22983553-22983575 ACTTGTGGATAGATCTCGTGGGG - Intergenic
1052580116 9:30344427-30344449 GTTTATGGCTAGATTTTGGGGGG + Intergenic
1053445833 9:38152554-38152576 TCTGGTGCATAAATCTTGGGTGG + Intergenic
1056784429 9:89580088-89580110 TCACGTGGATAGATTTTGGGTGG - Intergenic
1186789546 X:12983621-12983643 TGATATGGACAGATCTTTGGTGG + Intergenic
1189245572 X:39560913-39560935 TCTGAGGGAGACATCTTGGGAGG - Intergenic
1193293144 X:79801904-79801926 TCTTATGGTTCAATCTTGGAAGG + Intergenic
1194289109 X:92047082-92047104 TCTTTAGGATATATCTTGAGAGG + Intronic
1198052672 X:132963777-132963799 TCTTGTTGATATATCTTGGAAGG - Intergenic
1200233031 X:154454545-154454567 GCTTCTGGATAGATTTTGGGGGG + Intergenic
1200500533 Y:3942760-3942782 TCTTATTGGTTAATCTTGGGAGG + Intergenic
1200606626 Y:5271660-5271682 TCTTTAGGATATATCTTGAGAGG + Intronic
1201327986 Y:12786308-12786330 TGTTAGGTATAGAACTTGGGAGG - Exonic
1202019455 Y:20449676-20449698 GTTTATGGCTAGATTTTGGGGGG + Intergenic