ID: 1120789301

View in Genome Browser
Species Human (GRCh38)
Location 14:88564059-88564081
Sequence TCCCTAGGTGCTGGGAGTGC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 345391
Summary {0: 1, 1: 3, 2: 181, 3: 12121, 4: 333085}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120789294_1120789301 8 Left 1120789294 14:88564028-88564050 CCTGGGCTCAAGCAATTATCTGA 0: 1
1: 4
2: 305
3: 4904
4: 27041
Right 1120789301 14:88564059-88564081 TCCCTAGGTGCTGGGAGTGCGGG 0: 1
1: 3
2: 181
3: 12121
4: 333085
1120789292_1120789301 25 Left 1120789292 14:88564011-88564033 CCAGGCTGGTCTTAACTCCTGGG 0: 15
1: 123
2: 466
3: 1082
4: 2663
Right 1120789301 14:88564059-88564081 TCCCTAGGTGCTGGGAGTGCGGG 0: 1
1: 3
2: 181
3: 12121
4: 333085
1120789290_1120789301 26 Left 1120789290 14:88564010-88564032 CCCAGGCTGGTCTTAACTCCTGG 0: 19
1: 199
2: 441
3: 709
4: 2300
Right 1120789301 14:88564059-88564081 TCCCTAGGTGCTGGGAGTGCGGG 0: 1
1: 3
2: 181
3: 12121
4: 333085

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120789301 Original CRISPR TCCCTAGGTGCTGGGAGTGC GGG Intronic
Too many off-targets to display for this crispr