ID: 1120790772

View in Genome Browser
Species Human (GRCh38)
Location 14:88579542-88579564
Sequence GAGTGGAATCAGATGGAGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 283
Summary {0: 1, 1: 0, 2: 2, 3: 28, 4: 252}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120790766_1120790772 19 Left 1120790766 14:88579500-88579522 CCAAGGTTTTCTTCAAACACAGG 0: 1
1: 0
2: 0
3: 28
4: 229
Right 1120790772 14:88579542-88579564 GAGTGGAATCAGATGGAGCAGGG 0: 1
1: 0
2: 2
3: 28
4: 252

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120790772 Original CRISPR GAGTGGAATCAGATGGAGCA GGG Intronic
900084076 1:878840-878862 CTCTGGAATCAGATGGAGGAAGG - Intergenic
901091337 1:6643616-6643638 GACTAGACTCAGGTGGAGCAAGG + Intronic
901226325 1:7614841-7614863 AAGTGGATGCAGATGGAGCCAGG - Intronic
901654253 1:10760310-10760332 GAGTGGCATCTGATGGAGAATGG + Intronic
902915916 1:19639334-19639356 GATTATAATGAGATGGAGCAAGG - Intronic
902959638 1:19953905-19953927 CAGGGGAATCAGATGGAGGGAGG + Intergenic
904318708 1:29682661-29682683 CAGTGGGGTCAGAGGGAGCAGGG - Intergenic
904456336 1:30650403-30650425 GAGAGGCATCAGATGGAGCCAGG - Intergenic
904873214 1:33634818-33634840 GAGAGGAATGGGATGGAGCTGGG - Intronic
904978950 1:34480228-34480250 GAGAGGAATCAGAGGAGGCATGG + Intergenic
906074965 1:43045403-43045425 GTGTGGAAACAGATGGGGTATGG + Intergenic
906357241 1:45117157-45117179 GACCCGAATCAGAAGGAGCAAGG + Intronic
906772119 1:48494595-48494617 GAGTATACTCTGATGGAGCAAGG - Intergenic
908167606 1:61473888-61473910 GAGGGGAACCAGAGGGAGCCAGG - Intergenic
909559328 1:76992270-76992292 GACTAAAATCAGATGAAGCAGGG - Intronic
912756159 1:112326263-112326285 GAATGGAGGCAGCTGGAGCAAGG - Intergenic
912770296 1:112457262-112457284 GAGTGGTAGCAGATGGAGAAGGG - Exonic
915562385 1:156694739-156694761 GATGGGAATGAGATGGAGCAAGG + Intergenic
916055668 1:161067691-161067713 GAGAGGGCTGAGATGGAGCAAGG + Intronic
916282420 1:163066508-163066530 GAGAGTAATCAGATGGTGAAGGG - Intergenic
916677172 1:167073733-167073755 GGGTGGAGTCAGGTGGACCAAGG - Intronic
921563158 1:216682882-216682904 GAGTGCAATTAGTTGAAGCAGGG - Intronic
922067467 1:222158049-222158071 GAGTGGCACAGGATGGAGCAGGG - Intergenic
923093284 1:230755409-230755431 GAGTGTAAGTGGATGGAGCATGG + Intronic
923344715 1:233040596-233040618 GATGGCAATGAGATGGAGCATGG - Intronic
923643016 1:235784789-235784811 TAGTTAAATCAGATGGAGCTGGG - Intronic
924154363 1:241160916-241160938 GTGTGAAATCAGAAGGAGTATGG + Intronic
1062763170 10:43096-43118 CTCTGGAATCAGATGGAGGAAGG + Intergenic
1064753165 10:18552820-18552842 GAATGGAATGTAATGGAGCATGG - Intronic
1064753222 10:18553219-18553241 AAATGGAATCGAATGGAGCATGG - Intronic
1064753322 10:18553885-18553907 GAGTGGAATGAGATGGAGAATGG + Intronic
1064753392 10:18554386-18554408 GAATGGAATGAAATGGAGAATGG + Intronic
1064753531 10:18555380-18555402 GAATGGAATCGAATGGAGCATGG + Intronic
1064753564 10:18555615-18555637 GAATGGAATGGAATGGAGCATGG + Intronic
1064753828 10:18557381-18557403 GAGTGGAATGGAAGGGAGCATGG + Intronic
1064754085 10:18559127-18559149 GAGTGGAATGAAATGGAGAATGG + Intronic
1064754487 10:18561949-18561971 GAGTGGAATGGAATGGAGAATGG + Intronic
1064754614 10:18562823-18562845 GAATGGAATGAAATGGAGCGTGG + Intronic
1064754656 10:18563147-18563169 GAGTGGAACAAAATGGAGAATGG + Intronic
1064754728 10:18563647-18563669 GAATGGAATCGAATGGAGCATGG - Intronic
1064754814 10:18564290-18564312 GAGTGGAATGGAATGGAGAATGG - Intronic
1064754842 10:18564469-18564491 GAATGGAATGAAATTGAGCATGG - Intronic
1064754979 10:18565432-18565454 GAGTGGAATGAAATGGAGAATGG - Intronic
1064755020 10:18565744-18565766 GAATGGAATGAAATGGAGCGTGG - Intronic
1064755136 10:18566500-18566522 GAGTGGAATAGAATGGAGAATGG - Intronic
1064755167 10:18566712-18566734 GAATGGAATGAAATGGAGAATGG - Intronic
1064755184 10:18566831-18566853 GAGTGGAATGGAATGGAGAATGG - Intronic
1064755222 10:18567095-18567117 GAATGGAATGAAATGGAGGATGG - Intronic
1064755270 10:18567446-18567468 GAATGGAATGGAATGGAGCATGG - Intronic
1064755316 10:18567751-18567773 GAATGGAATGAAATGGAGAAAGG - Intronic
1064755362 10:18568100-18568122 GAATGGAATGGAATGGAGCATGG - Intronic
1064755523 10:18569212-18569234 GAGTGGAATGAAATGGAGAATGG - Intronic
1064755667 10:18570149-18570171 GAGTGGAATGGAATGGAGAATGG - Intronic
1064755806 10:18571080-18571102 GAATGGAATGGAATGGAGCATGG - Intronic
1064755994 10:18572280-18572302 GAGTGGAATGAAATGGAGAATGG - Intronic
1064756050 10:18572597-18572619 GAATGGAATGAAATGGAGAATGG - Intronic
1064756094 10:18572870-18572892 GAATGGAATGAAATGGAGAAAGG - Intronic
1065674294 10:28157653-28157675 GGGTGGAACCTGATGGAGAATGG - Intronic
1065805512 10:29390440-29390462 GCGTGGAAGCAGATGGCACAGGG + Intergenic
1068342166 10:55719248-55719270 GAGTGGAATAATATGGAGTAAGG - Intergenic
1070255927 10:74813316-74813338 GGGTGCACTCAGATGGAGAAAGG + Intergenic
1075981810 10:126746797-126746819 GACTGGAATCAGAGGGAGGGAGG + Intergenic
1076470367 10:130714268-130714290 GAGTGGAATGACGGGGAGCATGG - Intergenic
1076657360 10:132033603-132033625 GCGTGGAAACAGATGGATGATGG + Intergenic
1076886885 10:133267100-133267122 GAGTGGAAGGAGAAGGAGCCAGG + Intronic
1077408684 11:2393670-2393692 GAGTGGCATCAGAAGGCACAGGG - Intronic
1079143347 11:17829130-17829152 AACTGGAATCAGATAGACCAGGG + Intronic
1080826328 11:35852185-35852207 GAGTGAAATGGGATTGAGCAAGG - Intergenic
1081829518 11:46096380-46096402 GAGAGGAATTAGAGGGAGTATGG - Intronic
1083148134 11:60773644-60773666 GATAGGCATCAGAAGGAGCAAGG + Intronic
1084711683 11:70847657-70847679 GAGTGAATTGAGAGGGAGCATGG - Intronic
1085477833 11:76798980-76799002 GAGAGGATTCAGATGGAGGTAGG + Intergenic
1085794722 11:79528559-79528581 GAGTGGAAGCTGGTGGAGGAAGG - Intergenic
1086407518 11:86511317-86511339 GAGTGGAACAAGATGAAGTAAGG - Intronic
1086989852 11:93291003-93291025 GACAGGAATGAGATGGAGGATGG + Intergenic
1086998822 11:93392044-93392066 GAATAGAATCAGATGAAGGAAGG + Intronic
1087679364 11:101202346-101202368 GAGTGGAGGCAGAAGGAGCCAGG - Intergenic
1088181648 11:107120127-107120149 GAGAGGAAACAGATTGAGGAAGG + Intergenic
1088429727 11:109745705-109745727 AAGTGCAATCAGATGAAGCCAGG - Intergenic
1088702327 11:112424518-112424540 TGGAGGAATCAGATGGGGCATGG + Intergenic
1088946149 11:114514811-114514833 GAGAGGAAAAAGTTGGAGCAAGG - Intergenic
1089682345 11:120125690-120125712 GAGAGGAACCACATGGAGAACGG - Exonic
1093896449 12:24579975-24579997 GAGAAGTTTCAGATGGAGCATGG + Intergenic
1094374184 12:29773141-29773163 GAGTGAGTTCAGATGGAGAAGGG - Intronic
1094672703 12:32586599-32586621 AAGGGAAAACAGATGGAGCAGGG + Intronic
1094793682 12:33945278-33945300 GAGTGATAACAGATGGATCAGGG + Intergenic
1096549323 12:52361782-52361804 GAGTTGAATCAGATACACCAGGG + Intronic
1096863478 12:54547068-54547090 GAGAGGAATGAGAAGGAGCCTGG + Exonic
1097122959 12:56750073-56750095 CAGTGGAAACAGCTTGAGCAAGG + Intronic
1099055914 12:77840436-77840458 GAGGAGAATATGATGGAGCAAGG + Intronic
1100122628 12:91386411-91386433 GAGTAAAATCAGGTGGGGCATGG + Intergenic
1100220607 12:92501104-92501126 GGTTGGAATCAGATTGAGGAAGG + Intergenic
1100784404 12:98063906-98063928 AAGTGGAATCAGATCGTGAAAGG + Intergenic
1103218193 12:119219950-119219972 GAAGGGAATCAGATGGACCTGGG - Intronic
1112380261 13:98882295-98882317 GAGAGGAGTCAGAGGGAGCTGGG + Intronic
1112676268 13:101705697-101705719 GAGGGGGAGCAGATGGAGCAAGG + Intronic
1117461832 14:55952931-55952953 TAGGGGAATCAGATGGAGGTGGG + Intergenic
1117536455 14:56707558-56707580 GAGGAGAATCTGCTGGAGCAGGG - Intronic
1118597688 14:67448780-67448802 GACTGGAAACAGAGGGAGTAGGG + Intronic
1118992982 14:70812337-70812359 GAGGGGAATGGGGTGGAGCAGGG + Intergenic
1120790772 14:88579542-88579564 GAGTGGAATCAGATGGAGCAGGG + Intronic
1121797679 14:96748697-96748719 GAGTAAAATCAGATCAAGCAGGG - Intergenic
1121847849 14:97189566-97189588 GAGAGGAATCAGAAGGAAAAGGG - Intergenic
1123014198 14:105365789-105365811 GAGTGGCATCTGATGTGGCAGGG - Intronic
1124811554 15:32944250-32944272 GAGTGGCAGGGGATGGAGCAGGG - Intronic
1125906893 15:43401144-43401166 GAGTGGATTAGGATGGGGCAGGG + Intronic
1128557463 15:68641466-68641488 GGGAGGAAGCAGAAGGAGCAGGG + Intronic
1128882225 15:71254409-71254431 GAGTGGAGTGAGATGGGGCTTGG + Intronic
1131016834 15:89064924-89064946 GAGGGCAATGAGATGGGGCAGGG - Intergenic
1131261957 15:90892197-90892219 GTGGGGAATCAGATGGGGCAGGG - Intronic
1131522483 15:93126900-93126922 CAGTGGACACAGCTGGAGCAGGG + Intergenic
1133416791 16:5613126-5613148 GAGGGGCCTCAGTTGGAGCAGGG + Intergenic
1133623058 16:7544624-7544646 GAGAGCCTTCAGATGGAGCATGG + Intronic
1136594644 16:31239680-31239702 GAGTGGAATCCCCTGGGGCAGGG - Intergenic
1138182135 16:54948595-54948617 GAGTGGGGTCAGATGGAAGAAGG - Intergenic
1139243024 16:65413322-65413344 CAGTGGAATCAGACAGAACAAGG - Intergenic
1140194909 16:72847921-72847943 GAATGGAATGAGATGGAGGAGGG - Intronic
1145105148 17:20109216-20109238 CAGTGGAGTAGGATGGAGCAGGG + Intronic
1148387333 17:47243688-47243710 GATTGGTCTGAGATGGAGCATGG + Intergenic
1148806476 17:50266550-50266572 GATGGGGATGAGATGGAGCAGGG - Intergenic
1149419801 17:56498899-56498921 GCGTGAAATGAGATGGATCATGG + Intronic
1151405926 17:73886153-73886175 GTGTGGCCTGAGATGGAGCATGG - Intergenic
1151576851 17:74956810-74956832 GAGAGGAAGCAGAAGGAGCCAGG - Intronic
1151712298 17:75813725-75813747 GGGTGGGGTCAGATGGAGAAAGG - Intronic
1152956079 18:43427-43449 CTCTGGAATCAGATGGAGGAAGG + Intergenic
1155416072 18:25601259-25601281 GAGTGGATTCTGGTGGAGCTGGG - Intergenic
1157708712 18:49832581-49832603 GAATGAAGTCAGCTGGAGCATGG + Intronic
1160770668 19:829303-829325 GAAGGGACTCAGATGGAGGAGGG + Intronic
1160893817 19:1393526-1393548 CAGAGGGATCAGAGGGAGCAGGG + Intronic
1161652968 19:5496551-5496573 CAGTGTAGTCAGGTGGAGCATGG - Intergenic
1161704896 19:5815047-5815069 GAGGGGAAGCAGATGGGGCCGGG - Intergenic
1161920277 19:7260721-7260743 GGGTTGAATGAGATGGTGCAGGG - Intronic
1166869874 19:45864574-45864596 GTGTGGGCTCACATGGAGCAGGG + Intronic
1168406316 19:56112387-56112409 GAGAGGAAGCACCTGGAGCACGG + Intronic
926162078 2:10496151-10496173 GGGTGGGATCAGATGGAGGTGGG - Intergenic
927114742 2:19888966-19888988 GTGTGGAGGCAGATGGAGCAAGG - Intergenic
927399677 2:22696520-22696542 TAGAGGACTCAGAGGGAGCATGG + Intergenic
927712148 2:25332644-25332666 GCCTGGAATCAGAGGGAGCCAGG - Intronic
928927767 2:36596756-36596778 GAGTGGAATAAGATTGGGCGCGG - Intronic
929745214 2:44650162-44650184 TAGGGGTTTCAGATGGAGCATGG - Intronic
931692558 2:64847725-64847747 TAGTGCAATCAGAGGGAGGAGGG + Intergenic
932679966 2:73816473-73816495 TAGTAGAATCAGGTCGAGCAGGG - Exonic
932809278 2:74810701-74810723 GAGTCGAATCAGAGAGAGCATGG + Intergenic
934662808 2:96152328-96152350 GAGGGGCATGAGATGGAGCAGGG + Intergenic
935336750 2:102023517-102023539 GAGTGGCATAGGATGGAGAACGG + Intronic
936081111 2:109432905-109432927 GAATGGGATCAGGAGGAGCAGGG + Intronic
938207229 2:129434273-129434295 GAGTGGAATCTCAGAGAGCATGG - Intergenic
938387017 2:130873826-130873848 GGATGAAATCAGATGGACCAGGG - Intronic
938582683 2:132661435-132661457 GAATGGAATGGGATGCAGCATGG - Intronic
939996299 2:148923584-148923606 GAGTCGAATAATAGGGAGCAGGG - Intronic
942783670 2:179675607-179675629 GAGAGGAAACAGGTGGAGTAAGG + Intronic
943262329 2:185682099-185682121 GTGTGGAATGAGATAGTGCAGGG - Intergenic
943617356 2:190108692-190108714 TATTGGAATCAGAAGGAGAATGG + Intronic
945393213 2:209290259-209290281 GATTGGAATCTGGTGGAGTATGG - Intergenic
947698937 2:232216542-232216564 GGGTGGAATCAGAGGCAGAATGG - Intronic
948746881 2:240103094-240103116 GACTGGAATCAGATGGGGACTGG - Intergenic
1170919853 20:20667748-20667770 AAGGGGAAACAGATGGAGAAAGG + Intronic
1171948972 20:31404117-31404139 GAATGGAAAGAGATGGAGCAAGG + Intergenic
1173689534 20:44949498-44949520 GAGAGGAAGCAGAGGGAACATGG + Intronic
1176752664 21:10703160-10703182 GACTGGAATCAAATGGAATACGG - Intergenic
1179429828 21:41313349-41313371 GTGTTGAGTAAGATGGAGCAAGG - Intronic
1181392418 22:22593432-22593454 TAGGGGGAACAGATGGAGCAGGG + Intergenic
1182758241 22:32698873-32698895 CAGTGGCATGAGATGGAGGAGGG + Intronic
1182880311 22:33727328-33727350 GAATTGAATCAGATGGTGAATGG - Intronic
1184384711 22:44167502-44167524 GAGTGGAGTCAGAGGGGGCCAGG + Intronic
1184702451 22:46185185-46185207 GAGTGAAAACAGATGGAACATGG - Intronic
1184822414 22:46919243-46919265 GAGTGGAATTACATGGTGCGTGG + Intronic
1203302017 22_KI270736v1_random:83691-83713 GAGTGGAATCTAATGGAGTGCGG + Intergenic
950173124 3:10852944-10852966 GAGTGGAATGAGCAGGAGCTGGG + Intronic
950834170 3:15903453-15903475 GTGTGGAATCATAGTGAGCAGGG + Intergenic
950847828 3:16031859-16031881 AAGTGGAATCACATGGCACAAGG + Intergenic
952400782 3:32961347-32961369 GGGTGGTAAGAGATGGAGCAGGG + Intergenic
952433158 3:33245908-33245930 GAGTTGAATAAGATTGAACATGG + Intergenic
952539797 3:34356017-34356039 AAATGGAAACAGATGGAGAATGG + Intergenic
953577157 3:44122013-44122035 GAGTGGAAGCACAAGCAGCAAGG + Intergenic
954434740 3:50490020-50490042 GAGTGGATTCAGGTGGGGAAGGG + Intronic
956642923 3:71431588-71431610 GTGTGGGACCAGATGGACCAGGG - Intronic
957055231 3:75437453-75437475 GATTGGAAGCAGATTGAGGAAGG + Intergenic
958987986 3:100805269-100805291 GGGTGGAATCCTATGGAACATGG + Intronic
959273807 3:104250204-104250226 GTGTGGAAATTGATGGAGCAAGG - Intergenic
960165538 3:114397168-114397190 GAGTGGGAGCAAATGGAGAATGG - Intronic
960169968 3:114448452-114448474 GAGGGCAAACAGATGGATCAAGG + Intronic
960533292 3:118789248-118789270 GGGTGGAATGGGATGGGGCAGGG - Intergenic
961494958 3:127284655-127284677 GAGTGTAAGGAGATGGAGTAGGG + Intergenic
961626053 3:128264560-128264582 GAGAGGAGCCAGATGGGGCAGGG - Intronic
961728208 3:128946820-128946842 TAGTGAAATCAGATGCACCAAGG + Intronic
963792648 3:149600212-149600234 CAGTGTAATCAAATGGGGCAAGG + Intronic
964602989 3:158523769-158523791 GAGAGGAATGAGCAGGAGCATGG + Intronic
964792497 3:160465777-160465799 GAGTGAAATCATCTAGAGCAGGG + Intronic
965044418 3:163557352-163557374 TAGTGTCTTCAGATGGAGCATGG - Intergenic
965382347 3:168005526-168005548 CAGTGGAATCAGACTGAGCTGGG + Intergenic
965554716 3:170007094-170007116 CAGTGGAGTCAAATGCAGCAGGG + Intergenic
969755956 4:9150899-9150921 GATTGGAAGCAGATTGAGGAAGG - Intergenic
974782259 4:66567863-66567885 AAGTGGAATCAGATGTAGAATGG + Intergenic
980835708 4:138189296-138189318 TTGTGGAATGAGAAGGAGCATGG + Intronic
981629151 4:146798158-146798180 GAGTGGCATCAGATTTAGGAGGG + Intronic
981840068 4:149101472-149101494 GAGTGGAATGAGTTGGAGCCAGG + Intergenic
982550162 4:156787712-156787734 GAGATGAATGAGATGGAGTAAGG + Intronic
983723303 4:170886427-170886449 GAGAGGAATTAGATGTAGAAAGG + Intergenic
985402767 4:189608027-189608049 GTGTGGAGTCAGGTGCAGCAGGG - Intergenic
985440186 4:189978252-189978274 CTCTGGAATCAGATGGAGGAAGG + Intergenic
985816481 5:2131803-2131825 GAGCGGAAACAGAGGCAGCATGG - Intergenic
986048353 5:4063115-4063137 GAGTGGAAGTATATGGATCATGG + Intergenic
987777853 5:22392628-22392650 GACTTGAATGAGATGAAGCATGG - Intronic
991022250 5:61991975-61991997 GAGAGAAATGAGATGGAGAAAGG + Intergenic
992617187 5:78555993-78556015 GAGTGGAATCAAAAGTACCAGGG + Intronic
993630812 5:90283721-90283743 GCTTGGAATCAGATCAAGCAGGG + Intergenic
995533320 5:113112060-113112082 GGTTGGAATCAGGTGGACCAGGG - Intronic
997496370 5:134330339-134330361 GAGAGGAATGAGCTGGAGCATGG + Intronic
997523546 5:134538426-134538448 CAGTGGAATGAGAAGCAGCAGGG + Intronic
997829746 5:137139777-137139799 GAAGGGAGTCAGATGGGGCAGGG - Intronic
999648966 5:153746949-153746971 GAGTGGAATCAGATGGATCTGGG + Intronic
1000155174 5:158543678-158543700 GAGTGGTATCAGATTCAGCAAGG - Intergenic
1001138611 5:169123980-169124002 GAGAGGAATGAGCAGGAGCATGG - Intronic
1001187838 5:169593367-169593389 AAGTGGAATTAGATGAAGCCAGG + Exonic
1001996812 5:176168198-176168220 GAGTGGATTCAGATTAAACATGG - Intergenic
1005665745 6:28052448-28052470 GACTTGAATCAGAGGGATCAGGG - Intergenic
1006846756 6:37067550-37067572 GAGAGGAATGAGCAGGAGCATGG - Intergenic
1006933883 6:37704225-37704247 CAGTGGAGTCAGATGGGGCTGGG - Intergenic
1007708538 6:43806411-43806433 GAGAGGAGTCAGAGGGAGGAAGG + Intergenic
1008080334 6:47188134-47188156 GATTGGAAACAGATTGTGCAGGG + Intergenic
1008262593 6:49385465-49385487 GAATGGAAACAGAGGAAGCAAGG + Intergenic
1009933929 6:70209994-70210016 GAATGGAATAAAATGGTGCAAGG - Intergenic
1013079426 6:106799531-106799553 GAGTGGCATGACATGGAGAATGG + Intergenic
1013460508 6:110370861-110370883 GAGAGGAATGAGCAGGAGCATGG - Intergenic
1013822658 6:114174075-114174097 GAGTGGGAACAGATGAAGCTGGG - Intronic
1014028108 6:116672009-116672031 GAGTGTATTAAGATGGAGTAGGG - Intergenic
1018003468 6:159599749-159599771 TAGAGGATTCAGAGGGAGCATGG - Intergenic
1020814305 7:12886101-12886123 GAATGGAATCATATAGAACATGG - Intergenic
1020963249 7:14832771-14832793 TAGTGGAAGCAGATTGAGCAAGG - Intronic
1021036006 7:15799868-15799890 GAGTAGACTGAGAGGGAGCAAGG - Intergenic
1022289092 7:28984077-28984099 GATTAGCATCAGATGGAGAATGG - Intergenic
1023764431 7:43497586-43497608 GAGGGGCATAAGATGGAACAGGG + Intronic
1026837697 7:73649401-73649423 GGGGGGACTCAGAGGGAGCATGG - Intergenic
1027753280 7:82179174-82179196 GAGTGGAATTACATGGATTAGGG - Intronic
1029288573 7:99484167-99484189 GAGTGGAATCAGGAAGAGGAAGG + Intronic
1030263374 7:107589791-107589813 GATTGGAATCATATAGAGTATGG + Intronic
1032530407 7:132615286-132615308 GAGTGGTGGCAGAGGGAGCAGGG + Intronic
1033897650 7:146094450-146094472 AAATGCAAGCAGATGGAGCAGGG + Intergenic
1034838372 7:154373054-154373076 GAGAGGAAGCGGATGGTGCAGGG - Intronic
1035344614 7:158190000-158190022 GAGAGGAATCAGAGGGCGCCAGG - Intronic
1036047284 8:5158011-5158033 GTGGGGAATCTGATGAAGCAGGG - Intergenic
1036415568 8:8544602-8544624 CACTGGAATCAGAAGGAACAGGG - Intergenic
1036850359 8:12196412-12196434 GATTGGAAGCAGATTGAGGAAGG + Intergenic
1036871723 8:12438685-12438707 GATTGGAAGCAGATTGAGGAAGG + Intergenic
1037026155 8:14040619-14040641 GAGGAGAAGCAGAGGGAGCAGGG + Intergenic
1039116156 8:34093405-34093427 GATTGGTATAAGATGGAGAAAGG - Intergenic
1040639783 8:49320131-49320153 GAGTAGATTGAGAAGGAGCAGGG + Intergenic
1041938933 8:63365852-63365874 GGGTGGCATCAGCTGGTGCATGG - Intergenic
1044123739 8:88431461-88431483 GAGTGCACTCTGATGGAGCCTGG - Intergenic
1044681111 8:94778526-94778548 AAGTGGAAGCGGAGGGAGCAGGG - Intronic
1044717345 8:95112719-95112741 GAGAGGAATCGGCAGGAGCATGG - Intronic
1045748667 8:105455460-105455482 GAGTGGTATAAGATGAAGCAGGG + Intronic
1045857406 8:106780462-106780484 GAGAGGAATGGGATGGACCATGG - Intergenic
1046978506 8:120311035-120311057 AATTGGAAACAGATGAAGCAAGG + Intronic
1048327576 8:133451132-133451154 GAGTTGAATGAGATGGTCCAAGG - Intergenic
1048620463 8:136127332-136127354 GAGTGGAATTAGCTGCAGCAAGG + Intergenic
1049331813 8:142058638-142058660 GGGTGTTGTCAGATGGAGCAGGG - Intergenic
1049350056 8:142159644-142159666 GAATGGAATCAGGTGGTGCCTGG - Intergenic
1051049011 9:12909402-12909424 GGGTGGCATCAGCTGGTGCACGG + Intergenic
1052021749 9:23533007-23533029 CAGTGAAGTCAGATGGAGCCAGG - Intergenic
1056298773 9:85220812-85220834 GAGTGGAAACAGGTGGATGAAGG + Intergenic
1060257621 9:122046590-122046612 GACTGGAAAAAGATGGAGAATGG - Intronic
1060700081 9:125743534-125743556 GACTGTAATAAGATGAAGCAAGG + Intergenic
1060766614 9:126298718-126298740 CAGTAGAAACAGCTGGAGCAAGG - Intergenic
1061446025 9:130638629-130638651 GAGTGTCATCGGATGGAGCTGGG + Intergenic
1062571420 9:137187431-137187453 GCGGGGAACCAGAAGGAGCAAGG + Intronic
1203344901 Un_KI270442v1:27001-27023 AAGTGGAATCAAATGGAATACGG + Intergenic
1203348887 Un_KI270442v1:59661-59683 GACTGGAATCAAATGGAATAAGG + Intergenic
1203349897 Un_KI270442v1:71069-71091 GAGTGGAATCGAATGGAATACGG + Intergenic
1187527421 X:20066714-20066736 GGGTTTAAACAGATGGAGCAGGG - Intronic
1188509324 X:30917801-30917823 GAGAGGAATCAGTTGGAGAGGGG - Intronic
1188770554 X:34148063-34148085 GAGGGGAATGAGATTGGGCAGGG + Intergenic
1189171549 X:38914304-38914326 GAGCCCAATGAGATGGAGCACGG + Intergenic
1189566724 X:42249415-42249437 GAGTGGGATCAGGGGGAGCACGG - Intergenic
1190320124 X:49175156-49175178 GAGTGGAAACAGCTGGGGCAAGG + Exonic
1190472924 X:50800721-50800743 GACTGGAGCCAGATGGAGAATGG + Intronic
1192546670 X:72019961-72019983 CAGAGGAAGCAGATGGAGAAGGG - Intergenic
1193695585 X:84703752-84703774 GAGTTGAGTAAGTTGGAGCATGG + Intergenic
1196434746 X:115664792-115664814 CAGTGGCAGGAGATGGAGCAGGG - Intergenic
1197766602 X:130063394-130063416 GAGTGGTGGCAGAAGGAGCAGGG + Intergenic
1201127342 Y:10927060-10927082 CAGTGGAATGAAATGGAGTAGGG - Intergenic
1201136070 Y:10991077-10991099 GAGTGGAATGGGATGGAGTGAGG - Intergenic