ID: 1120791551

View in Genome Browser
Species Human (GRCh38)
Location 14:88588392-88588414
Sequence CAAAGTATCAAACAAGTACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 283
Summary {0: 1, 1: 0, 2: 2, 3: 24, 4: 256}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120791551_1120791553 -3 Left 1120791551 14:88588392-88588414 CCTTGTACTTGTTTGATACTTTG 0: 1
1: 0
2: 2
3: 24
4: 256
Right 1120791553 14:88588412-88588434 TTGACTAGGTACAGAATTATAGG 0: 1
1: 0
2: 6
3: 65
4: 533
1120791551_1120791554 27 Left 1120791551 14:88588392-88588414 CCTTGTACTTGTTTGATACTTTG 0: 1
1: 0
2: 2
3: 24
4: 256
Right 1120791554 14:88588442-88588464 CATTTTCTTCAGAACTTTGAAGG 0: 1
1: 2
2: 10
3: 64
4: 756

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120791551 Original CRISPR CAAAGTATCAAACAAGTACA AGG (reversed) Intronic