ID: 1120791551

View in Genome Browser
Species Human (GRCh38)
Location 14:88588392-88588414
Sequence CAAAGTATCAAACAAGTACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 283
Summary {0: 1, 1: 0, 2: 2, 3: 24, 4: 256}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120791551_1120791553 -3 Left 1120791551 14:88588392-88588414 CCTTGTACTTGTTTGATACTTTG 0: 1
1: 0
2: 2
3: 24
4: 256
Right 1120791553 14:88588412-88588434 TTGACTAGGTACAGAATTATAGG 0: 1
1: 0
2: 6
3: 65
4: 533
1120791551_1120791554 27 Left 1120791551 14:88588392-88588414 CCTTGTACTTGTTTGATACTTTG 0: 1
1: 0
2: 2
3: 24
4: 256
Right 1120791554 14:88588442-88588464 CATTTTCTTCAGAACTTTGAAGG 0: 1
1: 2
2: 10
3: 64
4: 756

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120791551 Original CRISPR CAAAGTATCAAACAAGTACA AGG (reversed) Intronic
903847398 1:26286618-26286640 CACAGTAGCAAACATGGACAGGG - Intronic
904621232 1:31776552-31776574 CTAATTAGCAAACAATTACACGG + Intergenic
904660971 1:32084526-32084548 CAAACTATCAATCAAGTATGAGG - Intronic
904764779 1:32836883-32836905 CAAACTATCAATCAAGTATGAGG - Intronic
907259130 1:53203864-53203886 CAAATTATCAATGAAGTATAAGG - Intronic
907717578 1:56941672-56941694 CAAATTATGAAACACGTACCTGG + Intronic
907749016 1:57244492-57244514 CAAAGGAACAGACAAGAACAAGG + Intronic
907952770 1:59199730-59199752 CAAAGTAGCAGACAATCACAGGG + Intergenic
909202197 1:72704811-72704833 CAAGGTTTCAACCAATTACATGG + Intergenic
911834555 1:102599991-102600013 CAAATTTTCAAACAAGTATGAGG + Intergenic
915412968 1:155717282-155717304 CACAGTATCAGACAGGGACAGGG - Intronic
915847296 1:159279778-159279800 CATACTAACAAAGAAGTACATGG + Intergenic
916101055 1:161393607-161393629 CAAATTATCAAACAAGAGGAGGG - Intergenic
916379573 1:164194997-164195019 CAAACTATGAAACTACTACAAGG + Intergenic
916603772 1:166321203-166321225 CCAACTATCAAAAAATTACAAGG - Intergenic
916752596 1:167736917-167736939 CAAAAAATCAATAAAGTACAAGG - Intronic
917361440 1:174180904-174180926 TAAAGCATGAAACAAGTACCAGG - Intronic
917636183 1:176939153-176939175 CATAGTATCATACACATACATGG + Intronic
918136253 1:181676475-181676497 AACAATATCAAACAAGCACAAGG - Intronic
918293853 1:183136369-183136391 CAAAATCTGAAACAAGTTCAAGG - Exonic
918337645 1:183535423-183535445 CACAGAATCAAACACCTACAAGG - Intronic
918342186 1:183577096-183577118 TTAGGTATCAATCAAGTACATGG + Intronic
919377432 1:196811750-196811772 CAAAATAGTAAACAAGTAAATGG + Intergenic
920337427 1:205254552-205254574 AAAAGTAGCAAACAAGAACCAGG - Intronic
921082444 1:211753308-211753330 CAAACTATCAACCAAGTTCGAGG - Intronic
921351492 1:214240294-214240316 CAAAATATCCAACATGTCCATGG + Intergenic
922755559 1:228094760-228094782 CAAAGTATCCAACAAGTGTTAGG - Intronic
922771081 1:228183331-228183353 CACAGTCTCACACAAGGACATGG + Intergenic
923308773 1:232713606-232713628 CAAACCATCAAACAAGTATTGGG - Intergenic
923811786 1:237326106-237326128 CAAAGTATCCATCAACTACTTGG - Intronic
924715888 1:246573768-246573790 CAAAGCGTTACACAAGTACATGG - Intronic
1063092361 10:2878378-2878400 CAAAGTAACAGACAAGGAAATGG - Intergenic
1063577270 10:7273151-7273173 CAAACTATCAATAAAGTATATGG + Intronic
1064329544 10:14380687-14380709 CACAGTATCTCACAAGTTCAGGG - Intronic
1065239521 10:23692035-23692057 CAAAATTTAAAACATGTACATGG + Intergenic
1067359696 10:45567386-45567408 CAAACTATGAAACTACTACAAGG - Intronic
1068122725 10:52800427-52800449 AATAGAATCAAACAAGTAGAAGG - Intergenic
1068317310 10:55363593-55363615 AAACGTATCAAATAAGTTCAAGG - Intronic
1068429123 10:56909581-56909603 CAAAGTATAAAAAAAGAATAAGG + Intergenic
1072594354 10:96857302-96857324 CCAAGTAATAAAAAAGTACAGGG - Intronic
1073676569 10:105654110-105654132 CAGAGTATTAAACAAGTATGAGG - Intergenic
1073863993 10:107780655-107780677 CAAAGTATTAAATAAACACATGG + Intergenic
1074947075 10:118290664-118290686 CAAGCTGTCAAACAATTACAGGG + Intergenic
1076038877 10:127226322-127226344 TGAAGGATCAAACAAGAACAGGG + Intronic
1077762410 11:5116874-5116896 CACAGTATCAGACTAGTCCATGG + Intergenic
1079558885 11:21796129-21796151 GAAAGTATAAAACTACTACAAGG - Intergenic
1083055793 11:59818415-59818437 CAAAATAACAAAAATGTACAAGG - Intergenic
1085003221 11:73060594-73060616 CAAAGCATGAAATAATTACATGG - Intronic
1085210340 11:74771109-74771131 CTAAGTATCAAAAATGCACATGG - Intronic
1090367330 11:126217796-126217818 CAAACTATCAAACAAGTGTGTGG - Intronic
1094682794 12:32680504-32680526 CAAACAAACAAACGAGTACAGGG - Intronic
1094784877 12:33836333-33836355 CTAAGTATCAAATAAATACATGG + Intergenic
1094873923 12:34619702-34619724 CAAAGTATAGAAAAAGAACATGG + Intergenic
1098484690 12:71006914-71006936 CAAGGAAACAAACAAATACAAGG + Intergenic
1099128932 12:78802328-78802350 CAGAGTATCTACCAAATACATGG + Intergenic
1099532683 12:83804498-83804520 CAAAGCATTTAAAAAGTACATGG - Intergenic
1100647480 12:96546395-96546417 CAAACAAACAAACAAATACATGG - Intronic
1100865717 12:98854513-98854535 CAAAGAAGGAAACAAGTTCAGGG + Intronic
1101171718 12:102104449-102104471 CAAACTTTAAAACTAGTACATGG - Intronic
1102693525 12:114780313-114780335 CAAGGTTTCAAATAAGTAAATGG - Intergenic
1106232824 13:27834506-27834528 CAAACAAAAAAACAAGTACATGG - Intergenic
1106566774 13:30892156-30892178 CAAAGTAACAAGAAAGTAGAAGG + Intergenic
1108557970 13:51614390-51614412 CAATGTCTTAAACAAGTAAACGG + Intronic
1110049597 13:70878589-70878611 CAAAGAACCAAAAAAGTAAATGG - Intergenic
1110251832 13:73389089-73389111 CAAATTATCAATCAATTACATGG - Intergenic
1112230775 13:97587366-97587388 CAAAGAATCACACAAATAAATGG - Intergenic
1113226073 13:108161031-108161053 CAAAGTATGAAATAAGGACTGGG + Intergenic
1114748859 14:25181359-25181381 CAAAGTATATAACAAGCAGAAGG - Intergenic
1114873548 14:26687421-26687443 CAATGCATCAAACAAGCACCTGG - Intergenic
1115552324 14:34515519-34515541 CAAAGAAACAAACAATTGCATGG - Intergenic
1116324551 14:43515439-43515461 AACAGAATCAAACAAGTAGAAGG + Intergenic
1116345750 14:43791190-43791212 CAATGTCTGAAACAACTACATGG + Intergenic
1118308051 14:64672537-64672559 CAAAGAAACAAAAAAGTATATGG + Intergenic
1118619091 14:67598449-67598471 CAAAGTCTCAAAGCAGTAAATGG - Intronic
1120356248 14:83438072-83438094 GAAAGTATAAAACCAATACAAGG + Intergenic
1120364883 14:83554928-83554950 TAAAATATCAAATATGTACAAGG - Intergenic
1120422483 14:84305449-84305471 AAAAATATAAAACAAATACATGG + Intergenic
1120791551 14:88588392-88588414 CAAAGTATCAAACAAGTACAAGG - Intronic
1121182591 14:91940774-91940796 CTAAGTATAAAATAATTACAAGG - Intronic
1123388950 15:19850157-19850179 TAAAGTATAAAACAAGTGCTGGG - Intergenic
1127004513 15:54551175-54551197 CAACGTATCAAACAAGGAGAAGG - Intronic
1128381362 15:67115520-67115542 CAAAGAATCCAACAAGAAAAAGG + Intronic
1129370154 15:75088117-75088139 CAAATTAACAAAGAAGTACAAGG + Intronic
1129642892 15:77399696-77399718 CAAACTATAAAACTACTACAAGG + Intronic
1129650829 15:77487442-77487464 AAAAGTATCACGGAAGTACATGG - Intergenic
1129803449 15:78434948-78434970 CAAAGAATCAAACAAGGGCCAGG + Intergenic
1130552736 15:84901585-84901607 CTAAGTGGCAAATAAGTACATGG + Intronic
1135854217 16:25992073-25992095 TAAAGTATCTACCAAGTGCATGG + Intronic
1138708967 16:58947366-58947388 CAAAGTAGGAAAAAAGAACAGGG - Intergenic
1139083222 16:63551782-63551804 AAAAGTAACAAACAACTAAAAGG + Intergenic
1142797654 17:2321198-2321220 CAAAGTGTGAAAAAAGTAGATGG + Intronic
1143070189 17:4285428-4285450 CAAAGTATCAATCAAGTATAAGG + Intronic
1143950354 17:10627682-10627704 AAAAATATAAAACAAATACAAGG - Intergenic
1144017576 17:11210762-11210784 CAAGCTATCAAAAAAATACAGGG - Intergenic
1148937052 17:51171753-51171775 CTCAGTATCAAATAAGCACAAGG - Intergenic
1148997278 17:51721953-51721975 CAAATTATCAAACATGAAGAGGG + Intronic
1149043969 17:52223111-52223133 CAAAGAACCAAATCAGTACATGG - Intergenic
1149211895 17:54313077-54313099 AAAAGTATAAAATAAGTCCAAGG - Intergenic
1150332990 17:64309275-64309297 CAAAGAATCAAGCAAGTTAAGGG - Intergenic
1150585986 17:66518291-66518313 CATATTATCAACCAACTACAAGG - Intronic
1154262859 18:12853070-12853092 CATAGTATCAAACATGTAGCTGG + Intronic
1155838362 18:30615280-30615302 CAAAGTCTCAAATAAATATATGG + Intergenic
1155916355 18:31561406-31561428 CAAACTATCAAGGAAGTAAAAGG + Intergenic
1157058805 18:44262300-44262322 CAAAGGAGAAAGCAAGTACATGG - Intergenic
1157975701 18:52324420-52324442 CAAATTATCAAACATGAAGAAGG + Intergenic
1158523347 18:58190146-58190168 CAAAGTATCAAATACATAGAAGG + Intronic
1160137430 18:76284404-76284426 ACAGGTATCAAACAAGTACATGG + Intergenic
1162966380 19:14158142-14158164 CCAAGTATCAAAGAAGTGCCTGG + Intronic
1164891481 19:31827279-31827301 CAAACTATCAATCAAGTATGAGG - Intergenic
1165182962 19:33988504-33988526 CAAATTATCCACCAAGTTCAAGG + Intergenic
1166226423 19:41398391-41398413 CAAAGGAGCAAAGAAATACAAGG - Intronic
929208858 2:39330367-39330389 AAAATTATCAATCATGTACAAGG + Intronic
930085747 2:47495878-47495900 CAAATTATCAAACATGAAGAGGG - Intronic
930455480 2:51603252-51603274 CTCAATATCACACAAGTACATGG - Intergenic
930905656 2:56563405-56563427 CAAAGCATTAAAAAAGTAGAGGG - Intergenic
931280481 2:60786971-60786993 CCAAGTTTCCAACAAGTACACGG - Exonic
931422882 2:62144092-62144114 TAAAGTATCAAACATGCACATGG - Intronic
933742185 2:85542835-85542857 CAACGTATTATACAAGTATATGG + Intronic
933753017 2:85615381-85615403 CAAACAAGCAAACAAGTTCAAGG + Intronic
933979993 2:87541500-87541522 CAAGGTATCACACAAGTGCAGGG - Intergenic
935475942 2:103524363-103524385 AAAAGAACCAAACAATTACATGG + Intergenic
936135850 2:109893073-109893095 TAAACTATGAAACTAGTACAAGG - Intergenic
936208847 2:110478412-110478434 TAAACTATGAAACTAGTACAAGG + Intergenic
936313828 2:111409291-111409313 CAAGGTATCACACAAGTGCAGGG + Intergenic
937645729 2:124264229-124264251 AATAGTATCAAACATTTACAAGG - Intronic
938920104 2:135987081-135987103 CAAAGTAAGAAAGAAGTACATGG - Intergenic
940333041 2:152496007-152496029 AAAAGTTGCAAACTAGTACAAGG + Intronic
941319076 2:164031978-164032000 CAAAGTACCAAACAGGGACTTGG + Intergenic
942232300 2:173871968-173871990 CAAAGTACCAAACAATTCCCTGG - Intergenic
942814664 2:180037760-180037782 CAAAAAAGCAAACAAGCACATGG + Intergenic
942977676 2:182038443-182038465 AAAAATATCAAACAAATATAAGG - Intronic
943278151 2:185895662-185895684 CAAAATAACAAATATGTACAAGG + Intergenic
943548095 2:189306305-189306327 CAAAGTTTCAATCAACTCCATGG - Intergenic
943837500 2:192532018-192532040 TAAAGGCTCAAACAAGTACAAGG - Intergenic
943837502 2:192532067-192532089 TAAAGGCTGAAACAAGTACAAGG - Intergenic
943992789 2:194719251-194719273 CAAAGTCTCAAACAACCATAGGG - Intergenic
944248413 2:197556831-197556853 CAAAGTAACATACAAGTTCCAGG + Intergenic
944350830 2:198724814-198724836 CAAACAAACAAACAAATACAGGG - Intergenic
945581548 2:211601704-211601726 CAAACTATCAAACAAGTAGGGGG + Intronic
945583303 2:211624685-211624707 CAAGGCATCAAACAACTACTGGG + Intronic
945765000 2:213965076-213965098 CAAATAAACAAACAAGTCCAGGG - Intronic
946101589 2:217329795-217329817 CATAGTGTCAAGCAAGTATAGGG - Intronic
946684803 2:222256931-222256953 AAAACTATCTCACAAGTACAGGG - Intronic
947395226 2:229680131-229680153 CAAAGTATAAGACAAATAAAAGG + Intronic
1168731034 20:80754-80776 CAAACTATCAAACTATCACAAGG + Intergenic
1170551147 20:17477654-17477676 CAAAATATCCAACATGCACATGG + Intronic
1171104019 20:22414934-22414956 CAAAGTAACAAAAAAGAAAATGG + Intergenic
1172179763 20:32995407-32995429 CAAACTATCAACCAAGTACAAGG + Intronic
1173354854 20:42277662-42277684 CAAAGTGTGAAGCAAGTCCATGG + Intronic
1174197063 20:48780777-48780799 CAAAGGTTCAAACAAAAACAGGG + Intronic
1175556776 20:59867622-59867644 CAAAGGATCAAACAAGCCAATGG + Intronic
1177289634 21:19094487-19094509 CAAAGAATCAAACAAGAATAGGG + Intergenic
1178141291 21:29686645-29686667 CAAAGTAGCAAGCAAGCACACGG - Intronic
1178613469 21:34108706-34108728 CAAAGTTGCAAACAAATACGAGG - Intronic
1180227031 21:46400139-46400161 CAAAGATTGAAACAATTACAAGG - Intronic
951549647 3:23864115-23864137 CAAACTATCAATCAAGTGCTAGG - Intronic
951875240 3:27417590-27417612 CAAAGTATCAAAAAATTAGCTGG + Intronic
951886511 3:27529902-27529924 CAAAATAACAAAGAACTACATGG + Intergenic
956848110 3:73202527-73202549 CAGAGTATTAAACCAATACAGGG - Intergenic
956954938 3:74326792-74326814 TAAAGTATGAAACAAATAAAAGG - Intronic
957692501 3:83590256-83590278 CAAACCATAAAACAATTACAGGG - Intergenic
957859053 3:85919763-85919785 AAAAGTAACAAAAAAGTACAGGG - Intronic
958115212 3:89207442-89207464 CAATGTAGCAAACCTGTACATGG + Intronic
958642211 3:96819261-96819283 AAAAGTAACAAAAAAGTAAAAGG - Intronic
958830388 3:99080644-99080666 CAAAGTATGGGACCAGTACACGG + Intergenic
959373087 3:105554071-105554093 CAGAGAATCAAACCAGTAGAGGG + Intronic
961854641 3:129857515-129857537 CAAAGTACTATACAAATACAAGG - Intronic
962013032 3:131411760-131411782 AATAGAATCAAACAAGTAGAAGG + Intergenic
962469931 3:135697639-135697661 CCATGTATCCAATAAGTACAAGG - Intergenic
962800881 3:138889550-138889572 CAAAATATCAAACAATTAGCTGG + Intergenic
964052124 3:152407564-152407586 AAAACTATGAAATAAGTACAAGG + Intronic
965527541 3:169737259-169737281 CAAACTATTAAACTATTACAAGG + Intergenic
966149642 3:176852924-176852946 AAAAATATCAAAAAACTACAAGG + Intergenic
966661227 3:182417258-182417280 CAAAGTATCAAAAGAAGACAAGG - Intergenic
967669298 3:192213363-192213385 TAGAGTTTCAAACAAGTAGAAGG - Intronic
967799165 3:193635698-193635720 CATAGTATAAAACAAGTATTTGG - Intronic
968182904 3:196610328-196610350 CAAGGTGACAAACATGTACATGG + Intergenic
971521285 4:27554902-27554924 CAAAATATCAAAAAAGTTCAAGG - Intergenic
972514777 4:39801393-39801415 CAAAGTAGCAGACAAGTAAATGG - Intergenic
975276745 4:72511159-72511181 CAAATTATGAAACTATTACAAGG + Intronic
975591236 4:76002061-76002083 CAAACTCTGAAACAAGTAAACGG + Exonic
976812690 4:89113291-89113313 CAAAGCATCAAAAAAGAACTTGG - Exonic
976858072 4:89628359-89628381 AAGAGTATCAAACATTTACAGGG - Intergenic
980594174 4:134930788-134930810 CACAGTTTCAATCAAGGACAAGG - Intergenic
980708533 4:136532550-136532572 CAATTTATCAATCAAGTACAGGG + Intergenic
981060568 4:140419614-140419636 CAAAAGATCAAACAAATATAGGG + Intronic
981696720 4:147566236-147566258 AAAACTATCAATCCAGTACAGGG - Intergenic
982079617 4:151776315-151776337 CAAACTATCAATCAAGTATGAGG - Intergenic
982821139 4:159941250-159941272 CAGAGTATCAAGCAAGCTCAGGG + Intergenic
983167984 4:164500664-164500686 CAATGTATAAATCAAGTAAAGGG + Intergenic
983443568 4:167819236-167819258 CAGAGTATCATTCAAGTATAAGG - Intergenic
984347991 4:178555892-178555914 TAAATTATCAAATAATTACATGG + Intergenic
987884689 5:23798939-23798961 TGAAGTTTCAAATAAGTACACGG - Intergenic
987952161 5:24688989-24689011 CAAACTATGAAACTACTACAAGG + Intergenic
988297350 5:29382777-29382799 CAAAGTTGCAAACAAAGACAGGG - Intergenic
990002735 5:50913560-50913582 CAAGGTCTCAAACAAGCACTGGG - Intergenic
994112968 5:96028281-96028303 GTAAATATCAAACTAGTACATGG + Intergenic
994135666 5:96283504-96283526 CAAAGTATCAAGGAACGACAGGG - Intergenic
996503503 5:124242923-124242945 CCATATATCAAACAAGTGCAGGG - Intergenic
998661614 5:144245234-144245256 CAAAGAATCAAACTAATAAATGG + Intronic
1000710883 5:164576246-164576268 AAAAGTATATAACAAATACAAGG - Intergenic
1003832278 6:10024749-10024771 CATACTTTCAAACAAGTAGAGGG + Intronic
1004440392 6:15644630-15644652 CTAAGAATCACACAAGTATATGG + Intronic
1006601331 6:35228292-35228314 CAAAGTAACAAAATAATACATGG + Intronic
1007022903 6:38540204-38540226 CAAAGTATCAAACAACTTTTTGG + Intronic
1007444070 6:41890866-41890888 CATAGTATATAACAAGTCCAGGG + Intronic
1008723540 6:54388689-54388711 AAAAGTATCAATGGAGTACATGG - Intronic
1008734220 6:54522324-54522346 TAAAGTATCCAACAAGTACCAGG + Intergenic
1009781319 6:68274689-68274711 CAAAATATCAATCAAGTATGTGG - Intergenic
1009898956 6:69787770-69787792 CAAAGTTTTAAAAAAGTAGAGGG + Intronic
1010457465 6:76074430-76074452 CAAACTATCAAACAAGTATGAGG - Intergenic
1012225514 6:96699337-96699359 CAAAGAAACAAACAAATAAAGGG - Intergenic
1014072598 6:117200617-117200639 GAAAGTGTGAAACAAGAACAAGG - Intergenic
1015295094 6:131582159-131582181 CAAAGTATCTGCCTAGTACATGG + Intronic
1015673439 6:135718313-135718335 CAAGCTATCAGACAAATACATGG + Intergenic
1015900692 6:138062488-138062510 CAAACTATCAATCAAGTATAAGG + Intergenic
1017051076 6:150394145-150394167 CTCATTTTCAAACAAGTACATGG + Exonic
1017267935 6:152472938-152472960 GAAAATTTCAAACAAGTGCAGGG + Intronic
1017344217 6:153361328-153361350 CAAAGTATAAATAAAATACATGG - Intergenic
1018374830 6:163201098-163201120 TAATGTGTCAAACAAGTATAAGG + Intronic
1020330689 7:7013942-7013964 CAAATTATCAAACATGGAGAGGG + Intergenic
1021090728 7:16479539-16479561 CCAAATATCATACAAGTCCATGG + Intronic
1021327750 7:19295712-19295734 CCCAGTATCAAAAAAGTTCATGG + Intergenic
1021781186 7:24108482-24108504 AAAACTATCAAACAAGTTCAGGG - Intergenic
1023427941 7:40058930-40058952 TATAGTATAAAAGAAGTACATGG + Intronic
1023490497 7:40734694-40734716 CAAAGTAACAAAAAAGTGTAAGG - Intronic
1024566618 7:50686539-50686561 CAAAGTATGGAACAAGCACAGGG + Intronic
1026535810 7:71237691-71237713 CAAACAAACAAACAAGTAAACGG + Intronic
1027762138 7:82292516-82292538 CAAATTATCAATCAAGTGTAAGG - Intronic
1028217881 7:88157463-88157485 CAAAATATCAAACAAGTGTGAGG + Intronic
1029002711 7:97172056-97172078 TAAAATATCAAAACAGTACAGGG + Intronic
1029709561 7:102292226-102292248 CAAAATATCAAAAAATTACCTGG + Intronic
1030416929 7:109257029-109257051 CACAGTATAAAAGCAGTACAAGG - Intergenic
1031056902 7:117001860-117001882 CAAAATATAATAAAAGTACATGG + Intronic
1032205706 7:129863325-129863347 CAAAGTACTAAACAGGGACATGG + Intronic
1032992724 7:137411776-137411798 CAAAGTATAAAACCACGACAAGG + Intronic
1034005107 7:147463319-147463341 AAAAGAATCAAAAAAGTTCAAGG - Intronic
1035138798 7:156736474-156736496 CAAAGTGTCAAACACATACGTGG + Intronic
1036553245 8:9833726-9833748 CAATGAAAGAAACAAGTACATGG - Intergenic
1038016143 8:23516797-23516819 CCAAGTATCATAAAATTACACGG + Intergenic
1038050336 8:23803454-23803476 CAAACTATCAGTCAAGTACATGG - Intergenic
1038600883 8:28940903-28940925 CAAAGTATAATACTAATACATGG + Intronic
1040356746 8:46625784-46625806 CAAATTATCAAACATGAAGAGGG + Intergenic
1040562451 8:48536044-48536066 GAAAGTTTCCAGCAAGTACATGG - Intergenic
1040564825 8:48556071-48556093 CAAAGTGTAAAACATTTACAAGG + Intergenic
1041183962 8:55279118-55279140 CAAAGTATCACAAAACTGCAAGG + Intronic
1041279004 8:56192453-56192475 AGAAGTAACATACAAGTACATGG + Intronic
1041365900 8:57104434-57104456 CAAACTATGAAACTACTACAAGG + Intergenic
1042160398 8:65888269-65888291 CAAAGGATCAGACGAGTATAAGG + Intergenic
1042365076 8:67926717-67926739 ACAAGTATCAATCATGTACAAGG + Intergenic
1043298571 8:78698057-78698079 CAAAGAATCAAGGAAGTACTGGG - Intronic
1044393568 8:91682055-91682077 CAAAGTAGCAAAAAACTAGATGG - Intergenic
1045373475 8:101548726-101548748 CAAAGTTTCAAAAAAGAGCATGG + Intronic
1045834065 8:106499527-106499549 CAAAGTATCACATAAGTTTATGG - Intronic
1047837113 8:128706094-128706116 TATAGTATAAAACAAGTATACGG - Intergenic
1047937344 8:129795860-129795882 AATAGAATCAAACAAGTAGAAGG - Intergenic
1048836148 8:138520739-138520761 CACAGGAATAAACAAGTACATGG - Intergenic
1050014370 9:1218518-1218540 CAAAGTATCCAACAAGGATGAGG + Intergenic
1050522447 9:6515478-6515500 CAAACTATAAAACTACTACAAGG - Intergenic
1050812299 9:9763753-9763775 CAAATTATCAAAAAAGAAGAAGG - Intronic
1051704760 9:19865730-19865752 CAAACTGTGAAACTAGTACAGGG + Intergenic
1055383794 9:75738944-75738966 GAAATTATCAAACAAGTTAAGGG + Intergenic
1056578117 9:87871083-87871105 CAAAGTGTTAAACAAGTGAATGG - Intergenic
1057241155 9:93410708-93410730 CAAACTATGAAACTACTACACGG - Intergenic
1059290446 9:113219143-113219165 CAAACTAACAAACAAAAACAAGG + Intronic
1188451735 X:30314508-30314530 CAAAGAAACAAACAAAAACAAGG - Intergenic
1192090438 X:68149822-68149844 CAGACACTCAAACAAGTACATGG + Intronic
1194546763 X:95245176-95245198 CAAAATATGAAACTACTACAAGG + Intergenic
1195939498 X:110156281-110156303 TAAAGTATAATAAAAGTACAAGG - Intronic
1196691972 X:118569620-118569642 GAAAGTATCACACAAGAAAATGG + Intronic
1197107851 X:122737004-122737026 CAAAGTTCCAAGCAAGTATATGG + Intergenic
1197979876 X:132205851-132205873 ATAAGTATAATACAAGTACAAGG - Intronic
1197996607 X:132382921-132382943 CCATTTATCAAACAAATACATGG + Intronic
1198176164 X:134157750-134157772 AAAAGTACCATACAAGCACAGGG + Intergenic
1198565846 X:137905126-137905148 TAAATTATCAAGCAAGTATATGG - Intergenic
1199029254 X:142977325-142977347 CAGAGCATCAAAGAAGTACGTGG - Intergenic
1200967861 Y:9117271-9117293 CAAAGCATCAAACCATTCCATGG - Intergenic
1202142902 Y:21746818-21746840 CAAAGCATCAAACCATTCCATGG + Intergenic
1202143956 Y:21758800-21758822 CAAAGCATCAAACCATTCCATGG - Intergenic
1202162775 Y:21952835-21952857 CAGTGTATCAGACAAGGACAGGG + Intergenic
1202228581 Y:22633533-22633555 CAGTGTATCAGACAAGGACAGGG - Intergenic
1202314576 Y:23562634-23562656 CAGTGTATCAGACAAGGACAGGG + Intergenic
1202556226 Y:26107961-26107983 CAGTGTATCAGACAAGGACAGGG - Intergenic