ID: 1120791746

View in Genome Browser
Species Human (GRCh38)
Location 14:88590371-88590393
Sequence GAGCCAGAGCAGAGGGAGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 976
Summary {0: 1, 1: 0, 2: 9, 3: 103, 4: 863}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120791746_1120791753 7 Left 1120791746 14:88590371-88590393 CCTGCCTCCCTCTGCTCTGGCTC 0: 1
1: 0
2: 9
3: 103
4: 863
Right 1120791753 14:88590401-88590423 TTGCTGCTGCTCCTGCACACTGG 0: 1
1: 1
2: 3
3: 34
4: 297
1120791746_1120791755 24 Left 1120791746 14:88590371-88590393 CCTGCCTCCCTCTGCTCTGGCTC 0: 1
1: 0
2: 9
3: 103
4: 863
Right 1120791755 14:88590418-88590440 CACTGGCCTGCTTGTCCTTCAGG 0: 1
1: 0
2: 5
3: 20
4: 207

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120791746 Original CRISPR GAGCCAGAGCAGAGGGAGGC AGG (reversed) Intronic
900322935 1:2093938-2093960 GGGCCAGGGCAGAGGGAGCCAGG + Intronic
900406093 1:2493649-2493671 TACCCAGAGCACAGGGAGGCTGG + Intronic
900412002 1:2516739-2516761 AAGCCAGTGCAGAAGGCGGCAGG + Intronic
900426881 1:2585009-2585031 GATGCAGAGCAGAAGGTGGCTGG - Intergenic
900471093 1:2855388-2855410 GAGCCTGCGAAGAGGGAGACAGG - Intergenic
900831061 1:4965642-4965664 GTGCCTGAGCTGAGGGAGTCTGG - Intergenic
901115528 1:6840805-6840827 GAGGCAGTGCTGAGGCAGGCAGG + Intronic
901131190 1:6963167-6963189 GAGCCAAAAGAGATGGAGGCTGG - Intronic
901227253 1:7620978-7621000 GGGCCAGAGCAGGTGGAAGCAGG + Intronic
901300452 1:8196565-8196587 GAGAGGGAGAAGAGGGAGGCAGG - Intergenic
901423285 1:9165036-9165058 GAGCCAGAGCAGCAGGGGGGAGG - Intergenic
901650221 1:10738719-10738741 GAGGGGGAGGAGAGGGAGGCAGG + Intronic
901925449 1:12563356-12563378 GAGCTAGAGCAGCTGGATGCAGG - Intergenic
901964979 1:12859194-12859216 CAGCGATACCAGAGGGAGGCAGG - Exonic
902232468 1:15036515-15036537 GAAGCAAGGCAGAGGGAGGCAGG + Intronic
902609389 1:17588285-17588307 GAGCCAGGGCTGGGGGAGGGAGG + Intronic
902707686 1:18217018-18217040 GACCCACAGCAGGGGGAGGGTGG + Intronic
903360572 1:22774405-22774427 CAGCCAGAGCAGGAGGAGTCAGG + Intronic
903416951 1:23190043-23190065 GGGACAGAGCAGAGGAAGGTAGG - Intergenic
903928973 1:26851281-26851303 GAGGCAGGGCTGAGGGAGCCTGG + Intronic
904010134 1:27384661-27384683 GAGGCACAGCAGAGGGAGCATGG - Intergenic
904068865 1:27777186-27777208 GAGTCAGGGAAGAGGGAGGGTGG + Intronic
904146237 1:28394322-28394344 GAGACAGAGCAGAGAGAGAAAGG + Intronic
904285056 1:29448698-29448720 GAGGCAGAGAAGGGGGAGGCTGG - Intergenic
904378100 1:30094416-30094438 GAGCCAGTCCATAGGGAGGCAGG + Intergenic
904533881 1:31186569-31186591 GAACCAGGGCAGGTGGAGGCAGG + Intronic
904621316 1:31777009-31777031 GGGCCAGAGCACAGGAAGGTAGG + Intergenic
904688160 1:32275217-32275239 GAGCCAGGGTTGGGGGAGGCTGG + Intronic
904807277 1:33140873-33140895 GAGCCTGAGCAGAAGGAGAAGGG - Intergenic
904842209 1:33379678-33379700 GAGCCAAGGCAGAGTGAGGGAGG - Intronic
905042674 1:34973193-34973215 GAGTCAACGCAGAGGGAGGAGGG + Intergenic
905237817 1:36562181-36562203 GAGGAAGAGCAGAAGGAGGAAGG - Intergenic
905253749 1:36666535-36666557 AAGCCAGGCCAGGGGGAGGCAGG - Intergenic
905316710 1:37086563-37086585 GGGCCTGAACAGACGGAGGCAGG - Intergenic
905852430 1:41283913-41283935 GAGCCAGCTCGGAAGGAGGCCGG - Intergenic
906152727 1:43597556-43597578 GAGGCAGGTCAGAGGGAGTCAGG + Intronic
906543155 1:46603667-46603689 GTGGCAGATCAGAGGCAGGCAGG - Intronic
906636991 1:47416433-47416455 GAGCCAGAGGAGGCGGCGGCTGG + Exonic
907280503 1:53344104-53344126 GACCCAGAGGAGAGGCAGCCTGG - Intergenic
907714939 1:56917565-56917587 GAGCCAAAGCAGATGGGAGCTGG + Exonic
907822803 1:57987725-57987747 GAGCGCCAGCAGAGGCAGGCAGG - Intronic
908124193 1:61013846-61013868 GAGCTAGAGCAGGGGGACACTGG + Intronic
909340745 1:74528282-74528304 GAGCCTGAGCAGGGTGAGGAGGG + Intronic
909456406 1:75854580-75854602 AAGCCAGAGCAGGGAGAGGACGG - Intronic
911084238 1:93963306-93963328 GACCCAGAGCAAAGGAAGGTGGG - Intergenic
911618334 1:100038543-100038565 CGGCCAGAGCAGAGGGCGGCAGG - Intronic
911982676 1:104586216-104586238 GAGGCAGAGCAGAAGCAGGGTGG + Intergenic
912457652 1:109808546-109808568 AGGCCAGAGGAGAGGGAGGTAGG - Intergenic
912516643 1:110220478-110220500 GAGGGTGAGCAGAGGGAGGGAGG - Intronic
913452028 1:118999042-118999064 GACCCAGAGCAGTGGGAGTTTGG + Intergenic
914196799 1:145451941-145451963 GAGAAACAGAAGAGGGAGGCGGG + Intergenic
914224364 1:145707867-145707889 AATCCAGGGCAGAGGGAAGCAGG - Intronic
914915726 1:151817934-151817956 GCCCCAGAGCAGAGAGAGGGTGG + Intronic
915143261 1:153779657-153779679 GAGCCAGGCCAGAAGAAGGCAGG - Intronic
915143396 1:153780390-153780412 AAGACAGAGCAGTGGGAGCCTGG - Intergenic
915342998 1:155186380-155186402 GAAGGAGAGCAGAGGGAGGAGGG - Intronic
915356145 1:155256030-155256052 GTGGCACAGCAGAGGGAAGCTGG + Exonic
915551869 1:156640054-156640076 GAGCCAGTGTGGAGGTAGGCTGG + Intergenic
915622491 1:157094323-157094345 GAGACAGAGAAGAAGGAGGCTGG - Intronic
915904231 1:159866189-159866211 GAGCCTGAGCCCAGGGAGTCTGG - Intronic
915953868 1:160207442-160207464 CAGGCAGAGCAGAGGAGGGCCGG - Intronic
916001375 1:160619661-160619683 CATCCAGAGCAGAGGAAGGTAGG - Intronic
916025152 1:160827238-160827260 GACCCAGAGGAGCGGGAGGTTGG - Intronic
916150803 1:161787488-161787510 GAGTCACAGCAGAGTGAGGAGGG - Intronic
916257492 1:162804595-162804617 GAGACAGAGCAATGGGAAGCTGG + Intronic
916716874 1:167454281-167454303 GAGCCACGGGAGGGGGAGGCTGG + Intronic
917336126 1:173926086-173926108 GAGAAACAGCAAAGGGAGGCTGG + Intergenic
917496192 1:175542218-175542240 GAGACAGAGCTGAGAGAGGGAGG - Intronic
917964556 1:180170090-180170112 GAGGCAGAGCTGGGGGAGGAGGG + Intronic
918050237 1:180967273-180967295 GAGCTGGAGGAGAGAGAGGCTGG - Intergenic
918135566 1:181670917-181670939 GAGCAAGAGCTGAAGGAGGAAGG + Intronic
918148147 1:181775976-181775998 GAGCCAGAACAGAGGTATGCAGG - Intronic
918248319 1:182680036-182680058 GAGCCAGAGCAGTGGTAGCGAGG - Intronic
918289310 1:183091477-183091499 GAGGAAGGGCAGAGGGAGGGAGG - Intronic
918682019 1:187367591-187367613 AGGCCAGAGGAGAGAGAGGCAGG + Intergenic
919014055 1:192006293-192006315 GAGCCAGTGAAGATGGAGACAGG - Intergenic
919477820 1:198051293-198051315 TAGCCAGAGCAGAAGGAAGGTGG + Intergenic
919523790 1:198621972-198621994 GAGAGAGAGAAGAGGGAGGGAGG + Intergenic
920524338 1:206655701-206655723 GGGCCAGATCAGAAGCAGGCTGG - Intronic
920578896 1:207086045-207086067 GAAGGGGAGCAGAGGGAGGCAGG + Intronic
920891688 1:209993207-209993229 GAGCCAGAAAAGAGTGGGGCTGG + Intronic
920912577 1:210232640-210232662 CGGCCTGAGCAGAGGGAGGGAGG + Intergenic
921080678 1:211736553-211736575 GATCCAGAGCAGTGTCAGGCAGG + Intergenic
922002460 1:221493880-221493902 GAGCAAGAGCAGAGTGAGCAAGG - Intergenic
922099740 1:222470777-222470799 GAGCCTGAGCAGGGTGAGGTGGG - Intergenic
922261775 1:223950269-223950291 GAGCCTGAGCAGATTGAGGTGGG - Intergenic
922735305 1:227975473-227975495 GAGCCTGAGCAGGGTGAGGTGGG + Intergenic
922871102 1:228902536-228902558 GAGCCAGAGAAGAAGGAGAGGGG + Intergenic
923434635 1:233956607-233956629 GAGGCAGAGCAGAGGGAAAGAGG + Intronic
923503462 1:234585539-234585561 GAGCAAAAGCAGAGGGTGGCAGG - Intergenic
923630736 1:235648477-235648499 GGGCCAGATCAGATGGCGGCTGG + Intronic
924116719 1:240754279-240754301 GAGACTGAGCAGAGGGAAGAGGG - Intergenic
1063041440 10:2342387-2342409 GACCAAGAGCACAGGGAGCCAGG + Intergenic
1063589406 10:7381432-7381454 GAGCCAGAGCAGATGACTGCTGG + Intronic
1063881679 10:10538254-10538276 CTGGCAGACCAGAGGGAGGCAGG - Intergenic
1063959849 10:11298097-11298119 GAGCCAGAACAAAGGGAAACAGG + Intronic
1064618352 10:17187696-17187718 AGGCCAGAGGATAGGGAGGCAGG + Intronic
1065099793 10:22321484-22321506 GCGCCGGAGCAGGAGGAGGCCGG + Exonic
1066107019 10:32165248-32165270 GAGTGGGAGGAGAGGGAGGCTGG + Intergenic
1066457739 10:35586415-35586437 GAGCCTGAACACACGGAGGCTGG - Intergenic
1066617300 10:37308229-37308251 GGGCAAAAGCAGAGGGAGGGAGG - Intronic
1066723941 10:38370281-38370303 GAGACAGAGCAATGGGAAGCTGG + Intergenic
1066733543 10:38453108-38453130 GAGCCTGAGCAGGGTGAGGTGGG + Intergenic
1067084165 10:43229435-43229457 GGGCAGGAGCAGAGGCAGGCTGG + Intronic
1068051623 10:51957206-51957228 GAGAGAGAGGAGAGGGAGGTAGG - Intronic
1068596169 10:58905170-58905192 TAGCCCCAGCAGAGGGTGGCAGG - Intergenic
1069336783 10:67360709-67360731 GAGCAAGAGCAGAGAGGGGGAGG + Intronic
1069521364 10:69124194-69124216 GCGCCGGAGCGGAGGGAGCCGGG + Exonic
1069628295 10:69881453-69881475 GACCCACAGCAGAGGGAGAGGGG + Intronic
1069857284 10:71448285-71448307 GAGCCAGAGCTGAAGGCAGCAGG - Intronic
1070590306 10:77796233-77796255 GAGCCCCAGCAGAGGGAGCAGGG + Intronic
1070600616 10:77864021-77864043 CACCCAGGTCAGAGGGAGGCTGG - Intronic
1070712651 10:78693929-78693951 GAGTCAGGGGAGAAGGAGGCTGG + Intergenic
1071430973 10:85606598-85606620 GAGCCAGAGCTGAGGTGCGCAGG + Intronic
1071531297 10:86391991-86392013 GAGAGGGAGCAGAGGGAAGCAGG + Intergenic
1072304025 10:94089227-94089249 GAGCCCCAGGAGAGGGAAGCAGG + Intronic
1072639051 10:97197047-97197069 GAGTCAGAGTAGCTGGAGGCTGG + Intronic
1072686803 10:97542430-97542452 GTGGGAGAGCAGAGGGAGGGAGG - Intronic
1073100095 10:101001994-101002016 GAGGCCCAGCAGAGGGAGGCAGG + Exonic
1073176313 10:101559635-101559657 GAGCCCGGGCAGAGAGAGACAGG - Intergenic
1073779913 10:106825783-106825805 GTGCCAGAGGAGAGGCAGGCTGG - Intronic
1074412990 10:113243843-113243865 GAAACAGAGAAGAGGGTGGCTGG + Intergenic
1074864620 10:117537550-117537572 GAGCTGGAGCTGATGGAGGCAGG + Intergenic
1075535924 10:123272114-123272136 GAGCCAGAGCAGCAAAAGGCAGG - Intergenic
1075664304 10:124219774-124219796 GAACCAGAACAGGGGGAGGAGGG + Intergenic
1076084090 10:127610054-127610076 GAGCCAGTGCTGAGGAAGCCAGG - Intergenic
1076268758 10:129132291-129132313 GATCCTTAGAAGAGGGAGGCAGG - Intergenic
1076307610 10:129476031-129476053 GAATGAGAGCCGAGGGAGGCAGG - Intronic
1076316517 10:129545628-129545650 TTGCAAAAGCAGAGGGAGGCTGG - Intronic
1076462361 10:130655948-130655970 GGGCCAGAGGAGAGGGGTGCAGG - Intergenic
1076649084 10:131975214-131975236 CAGCCAGCGCAGAGTGAGGCGGG - Intronic
1076671002 10:132121097-132121119 CAGTCAGAGAAGAGGCAGGCTGG + Intronic
1076677741 10:132156203-132156225 GAGACTGAGCCGAGGGAGGGAGG - Intronic
1076692371 10:132230406-132230428 GCGCCTGTGCAGAGTGAGGCTGG - Intronic
1076706340 10:132303906-132303928 GAGCGAGTGCAGTGGGTGGCGGG - Intronic
1076906531 10:133365090-133365112 GAGCCAGAGCTGGGCGCGGCCGG + Intronic
1076923862 10:133471504-133471526 GAGACAGCCCAGAGGGAGGAAGG - Intergenic
1076992256 11:281547-281569 GAGCCAGAGGAGGAGGAGGAGGG + Exonic
1076992537 11:282945-282967 CACACAGAGCAGAGGGAGGAGGG + Intronic
1077341198 11:2027150-2027172 GACCCTGGGCAGAGGGAGACAGG + Intergenic
1077368595 11:2171287-2171309 CAGCTGGGGCAGAGGGAGGCAGG + Intronic
1077464056 11:2725132-2725154 GAGCCAGGGCAGGGTGGGGCAGG + Intronic
1077539140 11:3138466-3138488 GAGGCAGTGCAGCTGGAGGCAGG + Intronic
1077636452 11:3844825-3844847 GGGCCAGAGGAAAGGGAAGCAGG + Intergenic
1078018282 11:7634006-7634028 GATCCAGAGCAGAGTGTGGCAGG + Intronic
1078141641 11:8697468-8697490 GACCCAGAGCAGAGGGAGCCTGG + Intronic
1078757864 11:14228418-14228440 GAACCACAGCTGTGGGAGGCAGG + Intronic
1079604088 11:22343586-22343608 CAGCCACAGCAGAGGGAAGGAGG - Intronic
1080699530 11:34632684-34632706 GGGCAAGAGCAGAGAGAGCCGGG - Intronic
1081462728 11:43286706-43286728 GAGCCAGAAGATGGGGAGGCAGG - Intergenic
1081674186 11:44958753-44958775 GGGGCTGAGCAGGGGGAGGCAGG + Intergenic
1081720548 11:45285681-45285703 GGGTAAGAGGAGAGGGAGGCTGG - Intronic
1081748441 11:45489378-45489400 GAGCCAGGTGGGAGGGAGGCAGG - Intergenic
1081806470 11:45893649-45893671 GACCCAGAGGTGAGGGAGGCCGG + Intronic
1083182556 11:60996530-60996552 GAGCCAGGGCCTCGGGAGGCGGG + Intronic
1083190698 11:61050026-61050048 GAGCTGGAGCAGAGGGAGCCAGG - Intergenic
1083275055 11:61592188-61592210 GGGCTGGAGCAGAGGGAGGATGG + Intergenic
1083308893 11:61774670-61774692 GAGCCCAACAAGAGGGAGGCAGG - Intronic
1083310385 11:61780804-61780826 GAGCCAGAGGAGAGGGGCGCTGG - Intronic
1083633227 11:64106321-64106343 GTGGTAGAGAAGAGGGAGGCTGG - Intronic
1083831604 11:65237017-65237039 AAGCCAGTGCAGATGGAGGTGGG - Intergenic
1084115711 11:67041857-67041879 GGGCCAGAGCAGAGGGGGGAAGG + Intronic
1084334057 11:68446661-68446683 TTGGCAGAGCAGAGGGAGGCAGG - Intronic
1084364026 11:68686014-68686036 GAGAAAGGGAAGAGGGAGGCAGG - Intronic
1084582468 11:70032510-70032532 GAGAGTGAGCAGAGGGAGGCGGG + Intergenic
1084666802 11:70580728-70580750 GAGCCAGGGCTGGGGCAGGCGGG + Intronic
1084891926 11:72240885-72240907 GAGACAGAGCGGAGGTAGCCTGG + Intronic
1084945432 11:72635882-72635904 GAGTGAGAGCAAAGGGAGACAGG - Intronic
1085224791 11:74909917-74909939 GAGCCAGAGCTCAGGGATCCTGG - Intronic
1085282884 11:75342326-75342348 GGCCCAGAGCAGAGGGAAGGGGG - Intronic
1085302401 11:75466280-75466302 GCCCCAGCACAGAGGGAGGCAGG + Intronic
1086526847 11:87737983-87738005 TGGCCAGAGCAGAGGGGAGCTGG - Intergenic
1087239749 11:95761534-95761556 GTGCCAAAGCAGGGGGAAGCTGG + Intergenic
1088026512 11:105190930-105190952 AGGCCAGAGTAGTGGGAGGCAGG - Intergenic
1088754170 11:112872200-112872222 GAGGCAGAGAAAAGGGAGGTAGG - Intergenic
1088807823 11:113368067-113368089 CAGCCATAGCAGGGGAAGGCGGG - Intronic
1089322217 11:117634116-117634138 GACCCAGGGCAGAGGGGGACCGG + Intronic
1089388389 11:118083040-118083062 GCAGCAGAGGAGAGGGAGGCAGG - Intronic
1089398813 11:118152820-118152842 GAGCGAGAGGAGGGGGAGGGAGG + Exonic
1089433261 11:118438884-118438906 GAGATAGAGCAGAAAGAGGCAGG - Intronic
1089499977 11:118926041-118926063 GAGTCAGACCACTGGGAGGCTGG - Intronic
1089567020 11:119377311-119377333 GAGCCAGGGAAGAGTGAAGCAGG - Intronic
1089693338 11:120200048-120200070 GAGCCAGGGCAGAGGGAGGGAGG + Intergenic
1089794611 11:120970262-120970284 GTGCTGGAGAAGAGGGAGGCTGG + Intronic
1090210957 11:124920971-124920993 GAGCATGCGCAGACGGAGGCGGG - Exonic
1090260431 11:125315103-125315125 AAGCCTGCTCAGAGGGAGGCAGG + Intronic
1090519075 11:127459531-127459553 GAGCTGGAGCAGAAGCAGGCTGG - Intergenic
1090860076 11:130645136-130645158 GAGACAGTGCAAGGGGAGGCTGG - Intergenic
1091007815 11:131969520-131969542 GAGACTGAGCAAGGGGAGGCAGG + Intronic
1091175658 11:133555039-133555061 GAGTCAAAGCACAGGGAGGTTGG + Intergenic
1091306296 11:134538400-134538422 ATGGCAGGGCAGAGGGAGGCAGG + Intergenic
1202824183 11_KI270721v1_random:82339-82361 GACCCTGGGCAGAGGGAGACAGG + Intergenic
1091444267 12:534676-534698 GAGCCGGAGCTGAGAGAGGCAGG - Intronic
1091513507 12:1153988-1154010 GACTCAGAGCAGGGGGAGGCAGG - Intronic
1091611083 12:2010326-2010348 GAGCCAGAGCAGAATGAGAAGGG + Intronic
1091797781 12:3307067-3307089 TGGGCAGAGCTGAGGGAGGCTGG + Intergenic
1092118623 12:6027517-6027539 GGGTCTGATCAGAGGGAGGCAGG + Intronic
1092486590 12:8907577-8907599 GGGCCTGAGCAGAGGGACTCAGG + Intergenic
1092579163 12:9820406-9820428 GAGCCACAGCAGGGGGTGGCTGG - Intergenic
1093368686 12:18337614-18337636 GAGCTGGAGCAGAGGGAGGCGGG + Intronic
1093668046 12:21838122-21838144 GTGACAGAGCAGAGGGAGCTGGG + Exonic
1095402474 12:41830811-41830833 AAGCAAGACCAGAGGGAGGGAGG + Intergenic
1095604622 12:44052366-44052388 GAGCCAGTGCATTGGGAGGCTGG - Intronic
1095781573 12:46065917-46065939 GAGCAAGAGAAGAGAGAGGGAGG - Intergenic
1096054109 12:48636646-48636668 GAGCAAGTGCAGAGGGAAGGGGG + Intergenic
1096244360 12:49975886-49975908 GGGACAGAGCAGAGGAAGGCAGG + Exonic
1096267449 12:50135095-50135117 GAGAGAGAGGAGAGGGAGGGAGG + Intronic
1096549430 12:52362540-52362562 GAGCCAGGGCAGGGAGAGGAGGG + Intronic
1096863814 12:54549533-54549555 GAGGGAGAGCAGAGGGAGGGGGG + Exonic
1097177804 12:57153324-57153346 GAGCCAAAGGAAAGAGAGGCAGG - Intronic
1097202883 12:57294655-57294677 GAGGCCAAGCAGAGGCAGGCTGG + Intronic
1097522775 12:60689392-60689414 GAGCCCCAGCAGAGGGACCCTGG + Intergenic
1098058256 12:66532500-66532522 GAGACAGGGAATAGGGAGGCAGG - Intronic
1098103376 12:67042811-67042833 AAGCCAGAGCAGTGGGAGCTGGG + Intergenic
1098305596 12:69099467-69099489 GAGGCAGAGAAGAAGGGGGCGGG + Intergenic
1098339235 12:69434649-69434671 TGGCTAGAGCAGAGGGAGGGAGG + Intergenic
1099831730 12:87852250-87852272 GGGATAGAGAAGAGGGAGGCAGG + Intergenic
1100263054 12:92950649-92950671 GAGGGAGAGAAGAGGGAGGAAGG + Intergenic
1100432986 12:94547010-94547032 GATCCAGAGCAGAGAGAGAGTGG - Intergenic
1100572091 12:95852441-95852463 GAGCCTGAGCAGGAGGAGGAAGG - Intergenic
1101001347 12:100361298-100361320 AATCCAGAGTAGAGTGAGGCAGG - Intronic
1101612417 12:106303334-106303356 GAGCCAGGGTAGAGGCAGGGCGG + Intronic
1101939452 12:109089234-109089256 GAGGGAGAGCAGAGGGACTCTGG - Intronic
1102027557 12:109722162-109722184 GAGGCAGCTCAGAGGCAGGCAGG + Intronic
1102523952 12:113497606-113497628 GTGCCAGAGAAGGGGGAGGCCGG + Intergenic
1102954137 12:117048524-117048546 GAGCCAGAACATAGTGGGGCTGG + Intronic
1103237232 12:119383559-119383581 GTGCGAGAGCAGAAGGAGCCAGG + Intronic
1103509514 12:121465033-121465055 AAGCCAGGGCAGTGGGGGGCAGG - Intronic
1103947103 12:124532733-124532755 GAGGCAGAGGAGGAGGAGGCTGG + Intronic
1104323245 12:127772023-127772045 GAGACAGAGGAGAGAGAGGTGGG + Intergenic
1104756435 12:131272525-131272547 GAGCCTGGGCGCAGGGAGGCAGG + Intergenic
1104809466 12:131611739-131611761 GAGCCAGGGCACAGGGAGCCTGG - Intergenic
1104997488 12:132667688-132667710 CTCCCAGAGCAGAGGGAGCCAGG + Intronic
1105303271 13:19153379-19153401 GAGCCAGTGTTGTGGGAGGCAGG - Intergenic
1105582915 13:21717909-21717931 CTGCCAGAGCAGAGGCAGGAGGG - Intergenic
1106026553 13:25960708-25960730 GGGCAAAAGCAGAGGGAGGGAGG - Intronic
1106139720 13:27002033-27002055 GAGCTAGTGCAGAGTGAGGCAGG - Intergenic
1106558997 13:30832945-30832967 TAGCCAGGGCAGGAGGAGGCTGG - Intergenic
1106590764 13:31096793-31096815 GAGCCAGAGCAGGCGTGGGCTGG - Intergenic
1106597852 13:31161850-31161872 GAGCCGCGGCAGAGTGAGGCAGG - Exonic
1106969108 13:35114579-35114601 GAGCCAGAGCCAAGTGAGTCTGG - Intronic
1107014903 13:35700486-35700508 GAGAGAGAACAGAGGAAGGCAGG + Intergenic
1107098268 13:36560170-36560192 GAGCCAGAGCAGGGGGGAGTTGG - Intergenic
1107837401 13:44422994-44423016 TAGCCAGAGGCGAGGGAGGAGGG - Intergenic
1107840549 13:44452481-44452503 GAGCCCGAGCACAGGGAGCCTGG + Intronic
1111165058 13:84447680-84447702 AAGCCAGAGCAGGTGGAGGCTGG + Intergenic
1111822206 13:93227850-93227872 GCGCGAGAGCAGCGGGAGGCGGG - Intronic
1112131398 13:96527762-96527784 TGGCTGGAGCAGAGGGAGGCAGG + Intronic
1112554257 13:100452243-100452265 GAGACAGGGGAGAGGGAGACAGG - Intronic
1112898935 13:104335970-104335992 GAGCAAGAGCAAAGTGAGCCTGG - Intergenic
1113222699 13:108123238-108123260 GAGGGAGAGCAGATGGAGGAAGG + Intergenic
1113373897 13:109746151-109746173 AAGGCAGGGCACAGGGAGGCTGG - Intergenic
1113891456 13:113737723-113737745 GAGCCAGGACAGGAGGAGGCCGG - Exonic
1114268259 14:21085664-21085686 GAGGAAGAGCAGAGGGCAGCGGG - Intronic
1114406219 14:22458812-22458834 GAGCAAGAGAAGAGGGTGGCAGG - Intergenic
1114454787 14:22847445-22847467 GAGCAAGAGGAGAGGGATGTCGG + Exonic
1114620642 14:24094295-24094317 GAGCCACAGCAGAGGCTGGCGGG - Exonic
1115851706 14:37594836-37594858 GAGCCCGTGCCGGGGGAGGCCGG - Intronic
1116494078 14:45539406-45539428 TAGGAAGAGTAGAGGGAGGCAGG - Intergenic
1117079101 14:52133083-52133105 GAGGCTGAGCTGAGGGAGGAGGG + Intergenic
1117531859 14:56667439-56667461 GAGTGAGAGCAGAGAAAGGCAGG - Intronic
1118362267 14:65066418-65066440 GTGCCAGAGAAGCGGGAGGGAGG - Intronic
1118775765 14:68973127-68973149 GAGGCAGAGAAGGGGGAGCCTGG + Intronic
1118900398 14:69981063-69981085 AAGGCAGAGCAGAAGGAGGCTGG + Intronic
1119103618 14:71903620-71903642 GAGACAGAGTAGAGGGTGGGAGG + Intergenic
1119109949 14:71962285-71962307 GTGGCTGGGCAGAGGGAGGCCGG + Intronic
1119295026 14:73526081-73526103 GTGCCAGAGGTGAGGGAGGGGGG - Intronic
1119781394 14:77278681-77278703 GAGACAGAGCAGGTGGAGGGCGG - Intronic
1120085398 14:80266759-80266781 GAGCCATATCAGAGTGTGGCTGG + Intronic
1120502200 14:85310696-85310718 GAGAGAGAGGAGAGTGAGGCAGG + Intergenic
1120526062 14:85578542-85578564 GAGGCAGAGCACAGGGAAGGAGG + Intronic
1120791746 14:88590371-88590393 GAGCCAGAGCAGAGGGAGGCAGG - Intronic
1120993291 14:90397194-90397216 GAGGAAGAGCAGAGGGAGCGAGG - Exonic
1121113621 14:91328997-91329019 GGGCCATAGCAGCAGGAGGCTGG + Intronic
1121626028 14:95385953-95385975 GAGCCAGCAGGGAGGGAGGCTGG - Intergenic
1122033799 14:98933131-98933153 GGGCCAGAGAAGCGGGTGGCAGG + Intergenic
1122412278 14:101531758-101531780 GAGCCAGGGCAGAGCGAAGAAGG + Intergenic
1122593403 14:102871450-102871472 GGGCCACAGGGGAGGGAGGCTGG + Intronic
1122597432 14:102903115-102903137 GAGTCAGAGCCGCGGGTGGCAGG + Intronic
1122623010 14:103070487-103070509 GAGCCAGTGATGAGGGAGGCAGG + Intergenic
1122777846 14:104130615-104130637 GATCCGGAGCTGAGGGAGGCTGG + Intergenic
1122797443 14:104212996-104213018 GGCCCAGAGCAGAGCCAGGCGGG - Intergenic
1122880501 14:104688717-104688739 GAGGGAGGGCAGAGGAAGGCAGG - Intergenic
1123042563 14:105496390-105496412 GGAGCAGAGCAGAGGCAGGCAGG - Intronic
1123105031 14:105837317-105837339 GAGGCAGGGCTGAGGGAGCCTGG - Intergenic
1123113114 14:105882169-105882191 GAGCCAGTGCAGACAGAGGCTGG - Intergenic
1123119714 14:105911037-105911059 CAGCCAGTGCAGACAGAGGCTGG - Intergenic
1123443482 15:20306010-20306032 GCGCCAGGGCAGAGGAGGGCAGG - Intergenic
1123627701 15:22238967-22238989 GAGCCAGCCCACAGGAAGGCCGG - Intergenic
1123996061 15:25718750-25718772 GAGGCAGGACAGAGGGTGGCAGG + Intronic
1124036136 15:26054914-26054936 GATCCAGGGCAGAGGGCAGCAGG + Intergenic
1124694056 15:31848598-31848620 GAGTCAGACCAGGGGAAGGCAGG - Intronic
1126289379 15:47056428-47056450 GAACCAAAGCAGAGGGAATCGGG + Intergenic
1126434715 15:48624826-48624848 GAGCCTGCACAGAGAGAGGCCGG + Intronic
1126564900 15:50084839-50084861 GATCCTTATCAGAGGGAGGCAGG - Intronic
1126784000 15:52161899-52161921 GAGCCAAAGCAGAGGCAGTTGGG - Intronic
1128072556 15:64806826-64806848 GAGGCAGAAGAGAGGAAGGCAGG + Intergenic
1128082457 15:64864760-64864782 AAGCCAGGACAGAGGGAGGCTGG + Intronic
1128530966 15:68447475-68447497 TAGCAAGGGCTGAGGGAGGCAGG + Intergenic
1128532615 15:68464912-68464934 GAGAGAGGCCAGAGGGAGGCTGG - Intergenic
1128586277 15:68853002-68853024 GAGCCCGAGCAGAGTGAGGAGGG + Intronic
1128724802 15:69980466-69980488 CAACCAGGGCAGAGGGAGGAAGG - Intergenic
1128743135 15:70096877-70096899 GAGCCCGAGCGGGGGGCGGCCGG + Exonic
1128842912 15:70864524-70864546 TGGCCAGAGCAGAGGGAGTGAGG - Intronic
1129327672 15:74809713-74809735 GAGGAGGAGCAGATGGAGGCAGG + Intergenic
1129424436 15:75454009-75454031 GCTCAAGAGCGGAGGGAGGCGGG + Intronic
1129773603 15:78218490-78218512 GACACAGAGCAGAAGGAGCCTGG + Intronic
1129868491 15:78926231-78926253 GAGGCAGGACTGAGGGAGGCTGG - Intronic
1130275397 15:82473553-82473575 GAGCTAGGACAGAGGGAGCCTGG + Intergenic
1130467757 15:84200948-84200970 GAGCTAGGACAGAGGGAGCCTGG + Intergenic
1130496508 15:84472594-84472616 GAGCTAGGACAGAGGGAGCCTGG - Intergenic
1130520912 15:84659956-84659978 GATGCAGAGGAGAGGGAGGGGGG - Intergenic
1130590049 15:85205546-85205568 GAGCTAGGACAGAGGGAGCCTGG + Intergenic
1130835551 15:87646257-87646279 GAGCCAGGGCAGTGGGGGACAGG - Intergenic
1130985722 15:88843296-88843318 GATGCAGAGCAGGGGGAGGGGGG + Intronic
1131297681 15:91165654-91165676 GAGACAGACCTGAGGGAGGAAGG + Intronic
1131370267 15:91875302-91875324 GGGTCAGAGGAAAGGGAGGCAGG - Intronic
1131390513 15:92044241-92044263 GAGGAAGAGCAGACGCAGGCAGG - Intronic
1131848861 15:96516518-96516540 CAACCAGACCAGATGGAGGCAGG - Intergenic
1131880034 15:96852501-96852523 GAGCCAGAGCTAAGGGAGCTGGG + Intergenic
1132148242 15:99441267-99441289 GAGCCAGACTTCAGGGAGGCTGG - Intergenic
1132396453 15:101478513-101478535 AAGCCACAGAAGAGGGAGGGAGG - Intronic
1132467214 16:82893-82915 GAGCAAGAGAAGAGGCAGGATGG + Intronic
1132611459 16:818380-818402 AGGCCAAAGCAGAAGGAGGCAGG + Intergenic
1132613656 16:829850-829872 GAGCCAGTGCTGATGGAGACAGG - Intergenic
1133346698 16:5075910-5075932 CAGGCAGATCAGAGGAAGGCAGG - Intronic
1133412667 16:5581120-5581142 GATCCAGAGGAGAAGGGGGCAGG + Intergenic
1133606301 16:7391396-7391418 AACGAAGAGCAGAGGGAGGCAGG - Intronic
1133807235 16:9134923-9134945 GAGCCAGAGCGGGTGGATGCGGG - Intergenic
1134026417 16:10957279-10957301 GAGCCACAGCTTAGGAAGGCTGG - Intronic
1134069498 16:11252044-11252066 GAGCCAGGGCAGTGTGGGGCGGG - Intronic
1134213082 16:12294521-12294543 GACAGACAGCAGAGGGAGGCGGG - Intronic
1134868481 16:17630236-17630258 GAGCCCTAGAAGAGAGAGGCAGG + Intergenic
1135116158 16:19725004-19725026 GAGGCAGAGCAGAAGGAGCCCGG - Intronic
1136111704 16:28067587-28067609 GAGCCAGAGAGGAGGGAGCCAGG - Intergenic
1136316212 16:29455829-29455851 GAGCCAGACCAGGGGGATCCAGG + Exonic
1136394470 16:29985633-29985655 GGGCGAGTGCAGAGGGAAGCAGG - Intronic
1136430789 16:30195171-30195193 GAGCCAGACCAGGGGGATCCAGG + Exonic
1136553260 16:30992969-30992991 CAGACAGGGCAGAGGGTGGCAGG + Intronic
1136560799 16:31038205-31038227 GAGGCACAGCAGAGAGGGGCTGG - Intronic
1136585191 16:31180047-31180069 GCGGAAGAGCAGGGGGAGGCAGG - Intergenic
1137906870 16:52332316-52332338 GAGCTAGAGCAGGGGGAGGGAGG - Intergenic
1138183767 16:54961154-54961176 GAGCCAGGGCAGAGGTAGTGGGG + Intergenic
1138201407 16:55091405-55091427 GAGCCAGGGCTGAGGGAGGCGGG + Intergenic
1139511357 16:67430290-67430312 GAGCCAGGCCAGAGGGACGTCGG - Intergenic
1139796133 16:69484502-69484524 TGGCCAGCGCAGAGTGAGGCCGG + Intergenic
1139810923 16:69616405-69616427 GAGCCAGAGAAGGGTGAGGAGGG - Intronic
1139835001 16:69831042-69831064 GATTGAGGGCAGAGGGAGGCAGG + Intronic
1140504556 16:75463566-75463588 GGACCAGAGCAGAGGGAAGGAGG - Intronic
1140512101 16:75516349-75516371 GGACCAGAGCAGAGGGAAGGAGG - Intergenic
1140693125 16:77503858-77503880 GAGACAGAGAAGAGGGAGGAGGG + Intergenic
1140753897 16:78049902-78049924 GAGGCAGAGTGGAGGTAGGCAGG + Intronic
1141461519 16:84180998-84181020 GAGACAGAGCAGAGGTGGGGCGG + Intronic
1141509884 16:84505189-84505211 GTGCCAGGGAAGAGCGAGGCAGG - Intronic
1141683058 16:85555282-85555304 GCGCCTGGGCAGAAGGAGGCAGG - Intergenic
1141721152 16:85756054-85756076 GAGGCAGAGCTGTGGGGGGCGGG - Intergenic
1141786092 16:86201816-86201838 CAGGCAGAGCTGAGTGAGGCGGG + Intergenic
1141976253 16:87518386-87518408 GAGCCAGCCCACAGGAAGGCCGG + Intergenic
1142415255 16:89937650-89937672 GAGCCAGTGCAGATGCAGGCAGG + Intergenic
1142429014 16:90016449-90016471 GGGCCAGGGCAGAGGCAAGCAGG + Intronic
1142499494 17:324273-324295 GAGGCGGAGCAGGTGGAGGCAGG - Intronic
1142762296 17:2049852-2049874 GACGCGGAGCAGAAGGAGGCGGG - Intergenic
1142795430 17:2303570-2303592 GAGGAGGAGGAGAGGGAGGCGGG + Intronic
1143022112 17:3922126-3922148 AATCCAGGGCAGAGAGAGGCCGG - Intergenic
1143078798 17:4366426-4366448 GCGCCGGAGCCGAGGAAGGCCGG + Exonic
1143487676 17:7263411-7263433 GAGCCAGATTATAGGGAGGACGG - Intronic
1143551461 17:7632880-7632902 GAGCCAGGCCTAAGGGAGGCAGG - Exonic
1143660086 17:8319229-8319251 GAGCCACAGAAGAGAGAGACTGG - Intronic
1143739335 17:8941213-8941235 GAGGCAGAGAGTAGGGAGGCAGG + Intronic
1143823187 17:9581536-9581558 GAGAGAGAGGAGAGGGAGGGAGG + Intronic
1144395205 17:14836617-14836639 GAGCCTTATAAGAGGGAGGCAGG + Intergenic
1144517447 17:15928457-15928479 GAGGCTGAGCATGGGGAGGCTGG + Intergenic
1144889938 17:18488837-18488859 GAGGCAGAGAACAGGCAGGCAGG - Intronic
1145142278 17:20455480-20455502 GAGGCAGAGAACAGGCAGGCAGG + Intronic
1145192163 17:20852235-20852257 GAGACAGCGCAGGGGGAGGAGGG + Intronic
1145253177 17:21307536-21307558 GGGTCAGAGGAGAGGGAGGGAGG + Intronic
1145323393 17:21780382-21780404 GGGTCAGAGGAGAGGGAGGGAGG - Intergenic
1145402387 17:22552279-22552301 GAGACAGCGCAGGGGGAGGAGGG + Intergenic
1145978889 17:28999821-28999843 GGGCCAGAGCAGAGTGATGTGGG - Intronic
1146109544 17:30075714-30075736 GAGCCTGAGCAGAGCGAGGAGGG - Intronic
1146172045 17:30641924-30641946 GAGCCAGAGAGGGGGAAGGCAGG - Intergenic
1146295300 17:31645374-31645396 GAGGCAGAGCAGGGCGAGGAGGG + Intergenic
1146314809 17:31798422-31798444 CAGCCAAGGGAGAGGGAGGCAGG + Intergenic
1146345503 17:32057960-32057982 GAGCCAGAGAGGGGGAAGGCAGG - Intergenic
1146786853 17:35728635-35728657 GAGCAGGGGCAGAGGTAGGCAGG + Intronic
1146793402 17:35765428-35765450 GAGGCAGAAGACAGGGAGGCTGG + Intronic
1147015389 17:37488233-37488255 GAGTCAGTGAAGAGGGAGGTGGG - Intergenic
1147141179 17:38461402-38461424 GAGCCACAGCAAGGGGAGTCAGG - Intronic
1147442941 17:40458470-40458492 GAGCCCGCGCAGCGGGCGGCAGG - Intergenic
1147686019 17:42287434-42287456 GGCCCAGAGGAGAGGGAAGCTGG + Intergenic
1147717182 17:42516378-42516400 GAGCCAGGCCAGAGGAAGCCAGG - Intronic
1147906958 17:43829801-43829823 AAGCCAGAGAAAAGGAAGGCTGG + Intronic
1147982436 17:44282770-44282792 GAGCCAGAGGAGGGGGAGCTTGG - Intergenic
1148889186 17:50795538-50795560 CAACCAGAGCAGGGAGAGGCAGG + Intergenic
1149285496 17:55159410-55159432 GAACTAGAGCAGAGGCAGGGAGG + Intronic
1149550793 17:57537957-57537979 GGGCCACAGCAGGGGGAGGCAGG - Intronic
1149635777 17:58168135-58168157 GAGACAGGGCAGGGGGAGGGGGG + Intergenic
1149864873 17:60145772-60145794 AAGCCAGGGCAGATGGAGGCTGG + Intergenic
1149923100 17:60677473-60677495 GAGCCGGAGGACAGGGAGACTGG - Intronic
1150632164 17:66887410-66887432 GTGCCAGTGGAGAGGGAGGGGGG - Intergenic
1151382371 17:73734739-73734761 GGAACAGAGCAGAGGGAGGGAGG - Intergenic
1151404104 17:73875800-73875822 GAGCCACAGGAGAGGGAAGCAGG - Intergenic
1151433872 17:74082164-74082186 GAGCCACAGCAGAAGAACGCTGG + Intergenic
1151450658 17:74196543-74196565 GGGACAGAGGAGAGGCAGGCAGG + Intergenic
1151781158 17:76246407-76246429 GACCCAGTGCACAGGGAGCCAGG - Intergenic
1151796772 17:76351859-76351881 GAGGGAGAGCAGAGGGGAGCAGG - Intronic
1152207277 17:78980867-78980889 GGGGCAGAGCAGAGGGAAGCAGG + Intergenic
1152238599 17:79150729-79150751 TAGCCAGAGAAGAGGCAGGTAGG + Intronic
1152285852 17:79413004-79413026 GAGACAGGGCAGAAGCAGGCTGG - Intronic
1152367460 17:79864856-79864878 GAGGCAGGGCAGAGCAAGGCAGG - Intergenic
1152453220 17:80396851-80396873 GGGCCAAAGCAGGGGGAAGCAGG + Exonic
1152476383 17:80521143-80521165 GAGCCAGAGGGCAGGCAGGCTGG - Intergenic
1152599076 17:81252467-81252489 GAGCCGGAGCAGGGAGAGGTTGG - Exonic
1153324624 18:3805419-3805441 GAGTTGGAGCAGAGAGAGGCTGG + Intronic
1153952243 18:10067385-10067407 GAGGCAGAGCAGGTGGAGACAGG + Intergenic
1153987790 18:10368591-10368613 GAGGGAGAGCAGAGAGAGGGAGG + Intergenic
1155311377 18:24527407-24527429 GAGACAGAGTAGAGCCAGGCTGG + Intergenic
1155825648 18:30439361-30439383 TGTCTAGAGCAGAGGGAGGCAGG - Intergenic
1156242631 18:35268117-35268139 GAGCCAGGGCACAGCGGGGCGGG + Intronic
1156461912 18:37326045-37326067 GAGTCAGGGCTGAGTGAGGCTGG - Intronic
1156501958 18:37565865-37565887 GAGAGAGAGGAGAGGGAGGGAGG - Exonic
1157231397 18:45919806-45919828 GAGTCAGAGCACATGTAGGCCGG - Intronic
1157488680 18:48107420-48107442 GAGGAAGAGGAGAGGGAGGAGGG + Intronic
1157562430 18:48657948-48657970 GAGCCAGAGGTGAGGGTGGTGGG + Intronic
1157818489 18:50748504-50748526 GAGCCCCAGGAGAGGGAGGCAGG - Intergenic
1158183534 18:54745156-54745178 GACCCAGAGCAATGGTAGGCAGG - Intronic
1158201727 18:54948949-54948971 AAGCAAGAGCAGAGGCTGGCAGG + Intronic
1158848172 18:61466863-61466885 GGGACAGAGAAGAGGGAGGCGGG - Intronic
1158958597 18:62567503-62567525 GAGCCAGCACAGAGGAGGGCTGG - Intronic
1159925975 18:74269400-74269422 GAGCCAACGCAGATGGAGGAGGG - Intronic
1160410685 18:78673635-78673657 GGACCAGAGCTGGGGGAGGCAGG + Intergenic
1160823511 19:1068784-1068806 GAGCCAGACCCAAGGGAGGATGG + Intronic
1161118540 19:2512698-2512720 CTGCCAGGGCAGAGGGAGGAGGG - Exonic
1161248919 19:3270334-3270356 GAGCCAGAGAAGGTGGAGGAGGG + Intronic
1161278837 19:3434245-3434267 GTGACAGAGGAGAGTGAGGCAGG - Intronic
1161316410 19:3619568-3619590 GAGCTGAAGCAGAGGCAGGCTGG + Intronic
1161458416 19:4381594-4381616 GAGGCAGGGGAGACGGAGGCAGG - Intronic
1161498145 19:4598448-4598470 GGGCCCGAGGAGAGGGAGGGAGG - Intergenic
1161526560 19:4759731-4759753 GAGCGGGAGCTGAGGGAGGGAGG + Intergenic
1161594370 19:5143750-5143772 GAGGCTGAGCAGCAGGAGGCTGG + Intronic
1161596647 19:5154164-5154186 TGGCTGGAGCAGAGGGAGGCAGG + Intergenic
1161713253 19:5861835-5861857 GAGCAAGAGATGAGGGAAGCTGG + Intergenic
1161776134 19:6263260-6263282 GAGGCAGAACAGAGGAAGGGTGG + Intronic
1161813014 19:6481603-6481625 GAGCCGGGGCAGAGGGGAGCTGG - Intronic
1161814325 19:6490307-6490329 GAGGGAGAGAAGAGGGAGGAAGG - Intergenic
1162098008 19:8322194-8322216 GAGACTGACAAGAGGGAGGCGGG + Intronic
1162174913 19:8823482-8823504 GAGGCAGAGCACAGGCAGGAGGG - Intronic
1162413825 19:10521956-10521978 CAGCCAGAGAACAGAGAGGCAGG + Intergenic
1162984639 19:14261746-14261768 GAGAAAGACAAGAGGGAGGCTGG - Intergenic
1162990378 19:14298113-14298135 GAGCCAGAGAGGGGGAAGGCAGG + Intergenic
1163104620 19:15116159-15116181 GAGCCAGCGCAGGGGGCCGCGGG + Exonic
1163670862 19:18627682-18627704 CCGCCAGAGCAGAGGGAGTGAGG - Intergenic
1163676872 19:18659820-18659842 GATCAGGAGCAGAGGGAGGTGGG - Intronic
1163768365 19:19176199-19176221 GAGCTAGGGGTGAGGGAGGCAGG - Intronic
1164061463 19:21679173-21679195 CTACTAGAGCAGAGGGAGGCTGG + Intergenic
1164464632 19:28476870-28476892 GAGCCAAATTAGAGGGAGGATGG + Intergenic
1164623134 19:29709307-29709329 GAGCCAGGGCAGGGAGAGACGGG + Intronic
1164686461 19:30169487-30169509 GGGCCATGGCAGAGGGAGCCAGG - Intergenic
1164732771 19:30518848-30518870 GAACCAGGGCAGAGGGATGGGGG + Intronic
1164830573 19:31317168-31317190 GAGCTGGAGGGGAGGGAGGCTGG - Intronic
1165045905 19:33104706-33104728 GAGCCAGCGGAGAGAGGGGCCGG + Intronic
1165316053 19:35055992-35056014 AGGCCAGAGCAGAGTGAGCCAGG - Intronic
1165320808 19:35084112-35084134 GAGCCAGAGATGGGGGAGCCTGG + Intergenic
1165424166 19:35736875-35736897 GAGCCAGAGCTGAGTCAGGATGG - Intronic
1165438826 19:35812328-35812350 GAGCCAGGGCCCAGGGAGGCTGG - Intronic
1165593169 19:36988489-36988511 TGGCCAGAGCAGAAGGAAGCAGG + Intronic
1165771902 19:38385137-38385159 GAGCCATTAGAGAGGGAGGCTGG - Intronic
1166119077 19:40674188-40674210 GAGACAGGTCAGAGGGAGACAGG - Intronic
1166121634 19:40690500-40690522 CAGCCAGGGCCGCGGGAGGCGGG - Exonic
1166178204 19:41089289-41089311 GAGACGGGGCAGAGAGAGGCAGG - Intronic
1166270163 19:41708616-41708638 GACTCAGGGCAGAGGGAGGAAGG + Exonic
1166313843 19:41977843-41977865 CAGGCAGTGCAGAGGGAGGTTGG + Intronic
1166329582 19:42070219-42070241 GAGAGAGAGAAGAGGGAGGGAGG + Intronic
1166513292 19:43425691-43425713 GGGGCAGTGCAGAGGGAGGGAGG + Intergenic
1166662734 19:44657774-44657796 GGGCCACAGCAAAGGGTGGCAGG - Exonic
1166719917 19:44990853-44990875 GACCGAGAGCACAGGGTGGCAGG + Exonic
1166849975 19:45755064-45755086 GAGCTAGGCCAGAGGGAGGGAGG + Intronic
1166996443 19:46721871-46721893 GGGCCAGGGCTGGGGGAGGCTGG - Intronic
1167015543 19:46838688-46838710 GAGCCAGAGGAGGGGGACGGGGG - Intronic
1167103984 19:47419812-47419834 GAGCCAGAGGAGAGAAAGGACGG - Intergenic
1167420319 19:49398980-49399002 GAGCCATACGAGAGGGAGGAAGG - Intronic
1167517126 19:49929908-49929930 GAGCCAGAGCAACGTGGGGCAGG - Intronic
1168058922 19:53879621-53879643 GAGCCCGACCAGAGAGAGGCGGG + Intronic
1168291757 19:55360641-55360663 GCCCCAGAGCTGAGGGAGGAGGG - Intronic
1168588676 19:57614946-57614968 GGGCCAGAGCAGTGGCAGGAGGG + Intronic
924981230 2:223376-223398 GAGACAGAGCTGAGGGAAGCTGG - Intronic
925156609 2:1653115-1653137 GTGCCAGAGCAGAGTGAGTGGGG + Intronic
925193808 2:1907530-1907552 GGACCAGATCAGAGGGAGGTAGG + Intronic
925253894 2:2465774-2465796 TAGGCAGAGAAGAGGGAGACAGG - Intergenic
925302774 2:2828792-2828814 CAGGCAGACCAGAGGGAGACAGG + Intergenic
925994627 2:9281993-9282015 GAGCATGAGCAGAGGGAAGAAGG - Intronic
926145681 2:10395996-10396018 CAGGCAGAGAAGAGGGAGGCGGG + Intronic
926339601 2:11894256-11894278 GATCCTGATAAGAGGGAGGCAGG - Intergenic
927213206 2:20651136-20651158 AGGCCAGGGCAGCGGGAGGCAGG - Intergenic
927436632 2:23072104-23072126 GAGCGTAGGCAGAGGGAGGCTGG - Intergenic
927478545 2:23432776-23432798 GCAACAGAGCAGAGGGAGTCGGG + Intronic
928096300 2:28407147-28407169 GAGGCAGAAAAGAAGGAGGCTGG - Intronic
928181498 2:29071650-29071672 GAGCCAGGGCCGGGAGAGGCTGG - Exonic
928203144 2:29264171-29264193 GAGACACAGCAGAGGGTGGGTGG - Intronic
928372841 2:30753500-30753522 GACCCAGAGCAGAGAGAGACTGG - Intronic
928515306 2:32039431-32039453 GAGCCAGAGCAGATGCTGGAGGG - Exonic
929423200 2:41816185-41816207 TGGCCAGAGCAGAGGGAGTATGG + Intergenic
930724822 2:54672807-54672829 GATCCAGAGAACTGGGAGGCGGG - Intergenic
931219835 2:60278993-60279015 GAGCCAGAGTAGAGGGAGGTAGG - Intergenic
931259289 2:60603176-60603198 GAGCCAGAGGTGAGGCAGGGTGG - Intergenic
932060826 2:68495905-68495927 GAGCCAGAGCAGTGGGAATATGG + Intronic
932322031 2:70829398-70829420 CAGCCAGGGCTGTGGGAGGCAGG + Intergenic
932334551 2:70922627-70922649 GAGGCAGAGGAGGGGCAGGCCGG + Intronic
932421378 2:71603410-71603432 GAGCCAGGCCAGAGGGTGGGTGG + Intronic
932424482 2:71620436-71620458 GAGGAAGAGCAGAGGGTGCCTGG + Intronic
932781574 2:74561806-74561828 AGGCCAGGGCACAGGGAGGCAGG - Intronic
933721082 2:85398206-85398228 CAGCCTGAGGAGGGGGAGGCTGG + Intronic
933819291 2:86095086-86095108 CAGCCAGAGCAGAGTGAGAGGGG - Intronic
933997246 2:87679095-87679117 GAGCCAGTTCAGAGCAAGGCTGG + Intergenic
934461478 2:94215362-94215384 GAACCAGAGCAGAGCAGGGCAGG - Intergenic
934774958 2:96931517-96931539 GAGACAGAAAAGACGGAGGCAGG + Intronic
935583248 2:104777722-104777744 GTGCCAGTGCTGAGGCAGGCAGG - Intergenic
935668990 2:105539156-105539178 GGCACAGAACAGAGGGAGGCAGG + Intergenic
935734465 2:106095897-106095919 GCGGCAGAGCAGAAGCAGGCGGG + Intronic
936141990 2:109948462-109948484 AAGACAGTGGAGAGGGAGGCAGG + Intergenic
936178677 2:110246410-110246432 AAGACAGTGGAGAGGGAGGCAGG + Intergenic
936202701 2:110423022-110423044 AAGACAGTGGAGAGGGAGGCAGG - Intronic
936296606 2:111271815-111271837 GAGCCAGTTCAGAGCAAGGCTGG - Intergenic
936537246 2:113321888-113321910 GAGCATGGGCAGAGGGAGGCCGG + Intergenic
937153402 2:119701444-119701466 GATTGAGAGCAGAGGGAGCCTGG + Intergenic
937262984 2:120598216-120598238 GAAGCAGTGCAGAGGGAGGCAGG - Intergenic
937466795 2:122139816-122139838 GGGCCAGAGAAGAGGGAAGAAGG + Intergenic
937478205 2:122233894-122233916 GAGCTATAGCAGAAGGAGACTGG - Intergenic
937642342 2:124228034-124228056 AAGCTGGAGAAGAGGGAGGCTGG + Intronic
937733216 2:125259563-125259585 GAGCCAGAGCACAGCACGGCCGG - Intergenic
938168175 2:129050653-129050675 GAGCCAAAGCAGGGTGAGGTGGG - Intergenic
938821475 2:134964421-134964443 AAAGCAGAGCAGAGGAAGGCAGG - Intergenic
938937292 2:136138179-136138201 GAGCCAGAGCTGTGTGAGGTGGG - Intergenic
939102094 2:137907094-137907116 GAGCCAGAGTAGAGTGAAGAGGG - Intergenic
939403791 2:141730212-141730234 GAGACGGAGAAGAGGGAGTCTGG + Intronic
940104303 2:150080785-150080807 GGGCAAGGGCAGAGGAAGGCAGG + Intergenic
940843334 2:158610809-158610831 GAGCTGGGGCGGAGGGAGGCTGG - Intronic
941540267 2:166773478-166773500 GAGGGAGAGCAGAGGCGGGCTGG - Intergenic
942418881 2:175787169-175787191 GGGCCAGAGGAGGGGGTGGCAGG + Intergenic
944037477 2:195312845-195312867 GAGCAAGAGGAAAGGGAGGAGGG + Intergenic
945624689 2:212188255-212188277 GAGGGAGAGAAGAGGGAGGGAGG - Intronic
946449660 2:219769081-219769103 GAGCAAGAACCCAGGGAGGCTGG - Intergenic
947567799 2:231205937-231205959 CAGTCACAGCAGAGGGAGGGGGG - Intronic
947869771 2:233428127-233428149 GAGCCAGAGGAGGAGGAGGTGGG + Intronic
948177428 2:235955043-235955065 GAGCAAGAGTAGGGTGAGGCCGG + Intronic
948399742 2:237674966-237674988 GAGCCTGGGCAGTGGGAGGAGGG + Intronic
948612080 2:239176271-239176293 GAGGCCGGGCAGAGGGAGGGAGG - Intronic
948767393 2:240230304-240230326 CAGCCAGAGAACAGCGAGGCTGG + Intergenic
948927790 2:241110581-241110603 GAGCCACAGCTCTGGGAGGCAGG + Intronic
1169195331 20:3679625-3679647 GGGACAAAGCAGAGGGAGGGGGG + Intronic
1169326295 20:4679381-4679403 CAGGCAGAGAAGAGAGAGGCAGG + Intergenic
1169422522 20:5471589-5471611 GAGCCAGCTCTGAAGGAGGCCGG - Intergenic
1169424519 20:5485637-5485659 GAGCCTGAACAGAGGGAGAGGGG + Intergenic
1169506463 20:6216541-6216563 GAGGAAGAGAAGAGGGAGGCAGG + Intergenic
1169660996 20:7978232-7978254 GAGAGAAAGAAGAGGGAGGCTGG - Exonic
1169976390 20:11333363-11333385 GAGCCAGAGCATAGAGGGGTGGG - Intergenic
1170594324 20:17793848-17793870 GAGGCTGAGCAGAGGCAGGATGG - Intergenic
1170716171 20:18832935-18832957 GAGAGAAAGGAGAGGGAGGCTGG + Intergenic
1171540296 20:25945672-25945694 GAACCAAAGCAGAGGGAATCGGG - Intergenic
1171800774 20:29614649-29614671 GAACCAAAGCAGAGGGAATCGGG + Intergenic
1171843328 20:30242043-30242065 GAACCAAAGCAGAGGGAATCGGG - Intergenic
1171994533 20:31721938-31721960 AAGCAAGCGCTGAGGGAGGCAGG - Exonic
1172011113 20:31846468-31846490 GAGAGAGAGGAGAGAGAGGCAGG + Intergenic
1172740675 20:37164221-37164243 GAGGGAGAGAGGAGGGAGGCAGG - Intronic
1173228325 20:41175002-41175024 GAGCCAGGGCAGAGGAATGTAGG + Exonic
1173473164 20:43339022-43339044 GAGACAGAGACGAGGGAGGGAGG + Intergenic
1173576392 20:44115365-44115387 GAGCCTGAGCAGCTGGAGGGTGG - Intronic
1173667322 20:44772255-44772277 GAGTCAGGGCAGAGAGGGGCAGG - Intronic
1174049677 20:47759003-47759025 GGGGCAGGGAAGAGGGAGGCGGG - Intronic
1174501687 20:50989575-50989597 GAGGCAGAGAAGGAGGAGGCTGG + Intergenic
1175412415 20:58779129-58779151 GAAGCAGAGAAGAGGGAGCCTGG - Intergenic
1175658483 20:60792326-60792348 GATCCTTAACAGAGGGAGGCAGG - Intergenic
1176090806 20:63317866-63317888 GAGGAAGAGGAGAGGGGGGCGGG - Intronic
1176213092 20:63934939-63934961 GAGTCAGAGCTAAGGGAGGGTGG - Exonic
1176389115 21:6154591-6154613 GAGCCAGGAAAGAAGGAGGCTGG - Intergenic
1177366912 21:20151454-20151476 TAGCCAGAGCCGGGGCAGGCAGG + Intergenic
1177764968 21:25447792-25447814 GAGCCAGAGAGGAGAGAGGAAGG - Intergenic
1178038912 21:28617283-28617305 GGGCTGGAGTAGAGGGAGGCAGG + Intergenic
1178236315 21:30845983-30846005 AATCCAGAGGAGAAGGAGGCAGG + Intergenic
1178239508 21:30882552-30882574 GAGGCAGAGCTGGGGGAAGCAGG + Intergenic
1178748297 21:35274969-35274991 GAGGGAGAGCAGAAGGAGGTGGG - Intronic
1179270415 21:39846357-39846379 AATCCAGAGCAGCGGCAGGCAGG + Intergenic
1179637757 21:42724303-42724325 CAGCAATAGCAGAGGCAGGCAGG + Intronic
1179734357 21:43383657-43383679 GAGCCAGGAAAGAAGGAGGCTGG + Intergenic
1179959328 21:44759330-44759352 GAGCCTCAGCAGAAGGAGCCAGG - Intergenic
1179973617 21:44850475-44850497 GAGCCAGAGCGGCTGGAAGCTGG + Exonic
1180856477 22:19049057-19049079 TAGCCAGGGCAAATGGAGGCCGG + Intronic
1181033901 22:20160883-20160905 GGGCCAGGGAAGGGGGAGGCAGG + Intergenic
1181149859 22:20875484-20875506 GACCCAGAGGAGAGGGAGGTTGG + Intronic
1181174331 22:21027318-21027340 GAGAGAGAGCAGAGGGCGGCAGG + Exonic
1181306100 22:21918136-21918158 GGTCTAGAGCAAAGGGAGGCAGG + Intergenic
1181397991 22:22634883-22634905 GCCACAGTGCAGAGGGAGGCGGG - Intergenic
1181509453 22:23382520-23382542 GGGCCAGGGGAGGGGGAGGCGGG - Intergenic
1181516715 22:23418300-23418322 GGAGCAGAGCAGAGGGAGCCGGG - Intergenic
1181651414 22:24261175-24261197 GCCACAGTGCAGAGGGAGGCGGG + Intergenic
1181822276 22:25485542-25485564 GACCCCGAGCAGAGGGAGGTGGG - Intergenic
1182697635 22:32207305-32207327 GTGCCAGAGCAGTAGGAGGGCGG + Intergenic
1183107757 22:35627213-35627235 GAGGCAGGGCAGAGGGAGACAGG + Intronic
1183243207 22:36673676-36673698 GAGCCAGAGCAGAGGACCGCAGG + Intronic
1183316888 22:37141837-37141859 CAGCCTGGGCAGAAGGAGGCGGG + Intronic
1183330640 22:37219036-37219058 CAGCAAGAGCAGATGGAGGGTGG - Intergenic
1183432478 22:37774188-37774210 AAGCCCAAGCAGAGGGTGGCTGG - Exonic
1183546171 22:38455688-38455710 CAGCGCGGGCAGAGGGAGGCGGG - Intergenic
1183579067 22:38712407-38712429 GAGGCTGGGCAGAGGAAGGCAGG + Intronic
1183976447 22:41515190-41515212 GAGCCAGAGCCTTGGGAGACAGG - Intronic
1184065735 22:42119389-42119411 GAGAGAGAGGAGTGGGAGGCAGG + Intergenic
1184241439 22:43213024-43213046 AGGCCAGAGCAGAGGGAGGCGGG + Intronic
1184248194 22:43246183-43246205 GAGGCAGGGCAGGGGGAGACTGG - Intronic
1184521270 22:44995746-44995768 GAGACAGAGATGAGGGAGGGAGG + Intronic
1184536992 22:45094195-45094217 TAGCCTGAGCAGCGGGAGGGTGG - Intergenic
1184670973 22:46012225-46012247 GACCCAGAGCTGAGGGACACTGG + Intergenic
1184692327 22:46122958-46122980 AAGCGAGAACAGAGGGAGGTGGG - Intergenic
1184715618 22:46280200-46280222 GAGCCAGGGCAGGAGCAGGCAGG + Intronic
1184892997 22:47390796-47390818 GAACGAAAGCAGCGGGAGGCGGG + Intergenic
1185246833 22:49777168-49777190 GAGGAAGAGCAGAGGGAGTCAGG + Intronic
1185316087 22:50179676-50179698 GAGCCAGGGAAGAGGAAGGTGGG + Exonic
949195591 3:1302490-1302512 GAGAGAGAGAAGAGGGAGGAAGG + Intronic
949414334 3:3799648-3799670 AGGCCAGGGCAGGGGGAGGCAGG - Exonic
950092349 3:10304893-10304915 GGCCCAGAGCACAGGGAGTCAGG - Intronic
950231364 3:11278870-11278892 AATCCAGAGCTGAGGGAGTCAGG + Intronic
950437815 3:12991303-12991325 GAGCCAAAGCAGGGCGAGGCGGG + Intronic
950464327 3:13144380-13144402 CACCCACATCAGAGGGAGGCAGG + Intergenic
950579699 3:13854135-13854157 AAGCCTGAGAAGAGGGAGGAAGG + Intronic
950698895 3:14726412-14726434 CATCCACTGCAGAGGGAGGCCGG + Intronic
950719349 3:14871577-14871599 GTGACAGAGGAGAGGGAGGGAGG + Intronic
951028176 3:17851378-17851400 AAGCAAGAGCAGAGAGTGGCAGG - Intronic
951037382 3:17948809-17948831 AAGAAAGAGCAGAGGAAGGCAGG - Intronic
951709551 3:25574574-25574596 ACGGCAGAGCAGTGGGAGGCCGG - Intronic
952269351 3:31817038-31817060 CAGCCAGAGCAGGGAGAGGATGG - Intronic
952272309 3:31845210-31845232 GAGCAGGAGAAGATGGAGGCAGG - Intronic
952342517 3:32457917-32457939 GAGGCAGAGCAGAGGGTGTGGGG + Intronic
952561123 3:34594756-34594778 GAGGCAGAGGAGAGGGAAGCAGG - Intergenic
952920114 3:38278182-38278204 GAGCATGAGCAGGAGGAGGCGGG - Exonic
953274739 3:41483808-41483830 GATCCTCATCAGAGGGAGGCAGG + Intronic
953610721 3:44445420-44445442 GAGCTGGCTCAGAGGGAGGCAGG - Exonic
953978033 3:47397049-47397071 GAGCCTGAGGAGAGGGAGAGAGG + Intronic
954291755 3:49653634-49653656 GAGGCTGAGCTGGGGGAGGCAGG - Exonic
954748551 3:52800803-52800825 GAGCCCTGGCAGAGGGAGGCAGG - Intronic
954896073 3:53976132-53976154 TAGCCAGAGCACAGAGAGGAAGG + Intergenic
955084641 3:55690919-55690941 GAGCTACAGGAGAGGGAGGGAGG - Intronic
956462378 3:69485137-69485159 GGGCCAGAGCAGCAGGGGGCTGG + Intronic
957473632 3:80694612-80694634 AGGCCAGAGCACAAGGAGGCTGG - Intergenic
958970494 3:100605613-100605635 AAGCCAGAGCAGGGAGAGGAGGG - Intergenic
959568231 3:107854619-107854641 GAACCAGAGAAGAGTGAGGAGGG - Intergenic
959933434 3:112006333-112006355 CACCCAGAGCAGTGGGAGTCAGG + Intronic
961043348 3:123692833-123692855 GAGACGGAGCAGAGTGAGCCTGG + Exonic
961060413 3:123823763-123823785 GAGCCAGAGCTGGGTGATGCAGG - Intronic
961479166 3:127168453-127168475 CTGCCAGAGCTGAGGGAGGGAGG + Intergenic
961567043 3:127771282-127771304 GAGCAGGACCAGAGGGAGGATGG - Intronic
961637858 3:128344219-128344241 GTGACAGAGTGGAGGGAGGCAGG - Intronic
961662304 3:128475881-128475903 CAGCCAGAGCTGGGGGAGGCTGG - Intergenic
962275712 3:134011871-134011893 GTGTGAGAACAGAGGGAGGCGGG + Intronic
962362826 3:134756016-134756038 GAGCCAGAGGGGCTGGAGGCAGG + Intronic
963275566 3:143326440-143326462 GAGGGAGAGAAGAGGGAGGAAGG - Intronic
963745803 3:149124365-149124387 GAGCCAGCGCAGGGTGAGGAGGG - Intergenic
964092254 3:152891545-152891567 GAGCAAGAGAAAAGGGAGGGAGG + Intergenic
964122170 3:153196325-153196347 GTGCCAGAGCACACAGAGGCTGG + Intergenic
964406174 3:156351806-156351828 GAGAGAGACCAGAGGAAGGCAGG - Intronic
964714646 3:159708979-159709001 AAGCCAGAGAACAGGGAGCCTGG + Intronic
965605860 3:170496904-170496926 GAGCCACAGTAGAGGCAGGCTGG - Intronic
966879393 3:184341452-184341474 CACCCAGAGGAGATGGAGGCAGG - Intronic
966882268 3:184357274-184357296 GAAGAACAGCAGAGGGAGGCAGG + Intronic
967109877 3:186283879-186283901 GAGTCAGACCAGAGGAAGGAAGG - Intronic
968010638 3:195271639-195271661 GAGGCCGAGCGGAGGGAGGCTGG + Intergenic
968464146 4:742117-742139 GAGCCTGGGCAGAGAGAGGAGGG - Intronic
968464167 4:742181-742203 GAGCCTGGGCAGAGAGAGGAGGG - Intronic
968464187 4:742241-742263 GAGCCTGGGCAGAGAGAGGAGGG - Intronic
968541096 4:1168833-1168855 AAGCCAGAGCTGAGCCAGGCTGG + Intronic
968547506 4:1206401-1206423 CTGCCAGGGCAGGGGGAGGCCGG + Intronic
968889332 4:3359280-3359302 GAGGGAGAGGAGAGGGAGGAGGG - Intronic
968910587 4:3475372-3475394 GAGGCAGAGAAGGGGGAGGTGGG + Intronic
969226490 4:5801856-5801878 GAACCAGGGCATGGGGAGGCAGG + Intronic
969319443 4:6402864-6402886 GTGGCAGAGAGGAGGGAGGCAGG + Intronic
969371563 4:6734507-6734529 GAGGCAAGGCAGAGGGCGGCTGG - Intergenic
969564195 4:7968027-7968049 GAGCCAGCTCTGAGGGATGCGGG - Intronic
969617445 4:8261995-8262017 GAGCCACAGCAGATGGAGGGGGG + Intergenic
970275200 4:14392140-14392162 GAGCCAGAGCAGAGCGATCCAGG - Intergenic
970444876 4:16115230-16115252 AAGGCAATGCAGAGGGAGGCTGG + Intergenic
970550592 4:17177188-17177210 CAAACTGAGCAGAGGGAGGCAGG + Intergenic
972330036 4:38056113-38056135 GAATCAGAGGACAGGGAGGCAGG - Intronic
972413233 4:38813893-38813915 CAGACAGAGCTGAGGGTGGCTGG - Intronic
973875455 4:55213760-55213782 GAGTCAGAGCATAGAGAGTCTGG + Intergenic
974918923 4:68212625-68212647 AAGGGAGAGCAGAGGGAGGGAGG + Intergenic
975101647 4:70520974-70520996 TGGCCAGAGCAGAGTGAGGGAGG + Intronic
975423816 4:74202553-74202575 GAGCCAGTGCTGTGGGAGGAGGG + Intronic
976096450 4:81513315-81513337 GAGCTATAGCAGAGGGAGGGAGG - Intronic
976207998 4:82640217-82640239 GAACCAGAGCCAAGGCAGGCAGG - Intronic
976704561 4:88007558-88007580 GGGCGAGGCCAGAGGGAGGCGGG + Intergenic
977574597 4:98662915-98662937 GAGCCCAAGAGGAGGGAGGCAGG - Intergenic
977609849 4:99020482-99020504 GAGCCTGAGGAGGAGGAGGCGGG + Intronic
979259892 4:118636095-118636117 GAGCCTGAGCAGGGTGAGGTGGG + Intergenic
979328492 4:119404530-119404552 GAGCCTGAGCAGGGTGAGGTGGG - Intergenic
980803157 4:137779324-137779346 GAGACTCAGAAGAGGGAGGCAGG - Intergenic
981310710 4:143295381-143295403 GAGGTACAGGAGAGGGAGGCTGG - Intergenic
985276852 4:188245698-188245720 GAGAAAGAGCAGTGGGAGGCAGG + Intergenic
985487326 5:158763-158785 CAGGAAGAGCAGAGGGAGGAGGG - Intronic
985519582 5:367225-367247 GAGCAAGTGCCCAGGGAGGCAGG + Intronic
985634075 5:1027494-1027516 GAGGCAGAGGAGAGGGAGCGGGG - Intronic
985827640 5:2204877-2204899 GAACCATAGGAGAGGGAGGCTGG + Intergenic
985937195 5:3106425-3106447 GAGGGAGAGCAGAGGGAGAGGGG - Intergenic
985970446 5:3373951-3373973 GGACCACAGCTGAGGGAGGCTGG + Intergenic
986829492 5:11560043-11560065 AAGCCACAGCAGAGCAAGGCAGG - Intronic
987114971 5:14718925-14718947 GAGACAGAGCAGAAGGATGAAGG + Intronic
987275320 5:16355913-16355935 GATCCAGAGCTGAGTGAAGCTGG - Intergenic
988616266 5:32778018-32778040 GAGCCAGAGTTGGGGGATGCTGG + Intronic
988874883 5:35432890-35432912 GAGCCAGGGTATAGGGACGCAGG - Intergenic
989084902 5:37665891-37665913 GAAGCAGAGGAGAGGGTGGCGGG - Intronic
989579729 5:43020635-43020657 AACCCAGAGCAGGTGGAGGCTGG - Intergenic
989605690 5:43242387-43242409 GAGCAGGTGCAGAGAGAGGCAGG + Intronic
989719811 5:44511819-44511841 GTAGCAGAGCAGAAGGAGGCAGG - Intergenic
992013060 5:72549842-72549864 GGGCCAGAGAAAAGGGAGGTGGG + Intergenic
992018936 5:72603523-72603545 GAACCAGAGCAGAAGGAGACAGG + Intergenic
993422718 5:87721519-87721541 GAGCCAGATGTGAGGGAGACTGG + Intergenic
995523881 5:113035403-113035425 AAACCAGGGCAGAGGGATGCAGG - Intronic
996167112 5:120237839-120237861 GAGGAAGAGGAGAGGGAGGGGGG - Intergenic
996404194 5:123090231-123090253 GAGGCGGAGGAGAGAGAGGCGGG - Exonic
997013273 5:129904170-129904192 GAGCAAGAGCTGGGGGAGGAGGG + Intergenic
997128262 5:131250567-131250589 GAGCCAGGGTAGGGGGAGGTGGG + Intronic
997208950 5:132066583-132066605 GAGCAAGGGCAGAGGGAGAGAGG + Intergenic
997210320 5:132073353-132073375 TGGCCAGAGAAGAGGAAGGCTGG + Intergenic
997463262 5:134070093-134070115 CAGACAGAGCAGAGGGCTGCTGG - Intergenic
997531976 5:134587055-134587077 GGGACAGAGGAGGGGGAGGCTGG - Intergenic
997578980 5:135005415-135005437 GAGCCACAGCTCAGGGTGGCTGG - Intronic
997732454 5:136191550-136191572 GAGCACGGGCAGTGGGAGGCCGG - Intergenic
997778024 5:136629140-136629162 GAGACAGAGCAAAGGAAGGTGGG - Intergenic
998005899 5:138656933-138656955 GAGCAAGAGCTGAGGTAGGGAGG - Intronic
998282092 5:140821807-140821829 AAGCCAGAGCAGCAGGAGCCGGG - Exonic
998510982 5:142713653-142713675 GAGCCAGAGCAGCGAGGAGCCGG - Intergenic
998542884 5:142999448-142999470 GAGAAAGAGGAGAGTGAGGCGGG + Intronic
998593895 5:143507476-143507498 GACACTGAGCATAGGGAGGCAGG - Intergenic
998856743 5:146401235-146401257 GGGCCAGGGCTGAGGGAGTCTGG + Intergenic
998957609 5:147453621-147453643 GAGCCGGAGCAGAAGAAGGAGGG - Intronic
999263798 5:150253554-150253576 GGACCAGAGAAGAGGGAGGAAGG + Intronic
999286051 5:150394998-150395020 GAGCCAATGGAGAGGGAAGCTGG - Intronic
999305418 5:150516200-150516222 GAGCAAGGGCTGAGGCAGGCAGG - Intronic
999327013 5:150649896-150649918 TAGCCATGGTAGAGGGAGGCAGG - Exonic
999737544 5:154523917-154523939 CACCCAGAGCAGAGAGAGCCTGG + Intergenic
1001156064 5:169273229-169273251 TGGCCACAGGAGAGGGAGGCAGG + Intronic
1001274453 5:170340261-170340283 TAGAAAGAGGAGAGGGAGGCTGG - Intergenic
1001389679 5:171368869-171368891 AGGCCACAGCAAAGGGAGGCGGG + Intergenic
1001547405 5:172579168-172579190 GTTCCAGAGTAGAGGGAGGTGGG - Intergenic
1001652640 5:173327030-173327052 GCGCCAGAGGAGGGGGAGGGTGG + Intronic
1001888099 5:175314166-175314188 GACCCAGAGTTGGGGGAGGCAGG - Intergenic
1002039910 5:176505394-176505416 GAGCCAGAGCAGGGTAAGGAGGG + Intronic
1002159927 5:177309059-177309081 AAGACACAGCAGAGGGAGCCTGG + Intronic
1002206198 5:177564180-177564202 GAGCAAGAGGAGAGGGAGGAAGG - Intergenic
1002853812 6:1020426-1020448 GAGACACAGCTGAGGGAGGCAGG + Intergenic
1003130373 6:3390363-3390385 GGGGCAGAGAAGAGGGATGCAGG - Intronic
1003153191 6:3570090-3570112 GAGGGAGAGGAGAGGGAGGGAGG - Intergenic
1003869342 6:10389952-10389974 CCGCCAGGGCCGAGGGAGGCGGG + Intergenic
1005498670 6:26411418-26411440 GAGCTGTAGAAGAGGGAGGCTGG + Intronic
1006302338 6:33200271-33200293 GAGCCGGAGCCAGGGGAGGCTGG - Exonic
1006303921 6:33207969-33207991 GAGCCAAAGCAGAGGGTGGAGGG + Intergenic
1006341282 6:33448546-33448568 GAGGGAGGCCAGAGGGAGGCTGG - Intronic
1006613942 6:35312195-35312217 GAGCCTGGGCAGAGGGAAACAGG - Intronic
1006618224 6:35343850-35343872 GAGTGAGGGCAGAGAGAGGCTGG - Intronic
1007313054 6:40961950-40961972 CATCCAGAGCGGAGGGAAGCTGG - Intergenic
1007725169 6:43911677-43911699 GAGCCGGAGCTGGGGGAGGGGGG - Intergenic
1007983625 6:46185305-46185327 CAGGCAGAGCTGAGGGAGGAAGG - Intergenic
1008055949 6:46946224-46946246 CAGCCAGAGAAGAAGGAGGGAGG + Intronic
1008536898 6:52513132-52513154 GAGGCAGAGCAGTGGGAGTGTGG - Intronic
1008722046 6:54366577-54366599 GAGATAGAGAAGAGGGAGGGAGG + Intronic
1010579085 6:77572001-77572023 GAGTCAGAGCAGAAGGACGTAGG - Intergenic
1011740097 6:90350871-90350893 GTGGCAGAGGAGAGGGAGGGAGG - Intergenic
1011843346 6:91529306-91529328 AAGAAAGAGGAGAGGGAGGCAGG + Intergenic
1013402804 6:109815340-109815362 GAGCCCAAGCAGGGAGAGGCAGG - Intronic
1013558364 6:111280321-111280343 GGGACAGAGCAGAGGGCAGCAGG - Intergenic
1013581296 6:111537047-111537069 GTGCCAGAGCTGAGGGAAACAGG + Intergenic
1013935011 6:115583536-115583558 TGGCCAGAGCCCAGGGAGGCTGG - Intergenic
1014104946 6:117551066-117551088 GAGCAAGATCAGTGGGAGACAGG - Intronic
1014225436 6:118841364-118841386 GGGCCAGAGGAGAGAGAGGCAGG - Intronic
1014548928 6:122765723-122765745 GAGCCAGATGAAAGGGAGGTGGG - Intergenic
1015544562 6:134348140-134348162 GAGGGAGAGCAGAGGCGGGCTGG + Intergenic
1015777815 6:136832294-136832316 GAGCTAGAGCAGCTGGATGCAGG + Intronic
1015819920 6:137249870-137249892 GAGGCAGTGAAGAGGGAGCCAGG - Intergenic
1015925643 6:138307986-138308008 GGGCGAGAGCACAGGGAAGCTGG - Intronic
1016395760 6:143621850-143621872 GAGCCAGAGCAGGGGGACCTGGG - Intronic
1017220800 6:151963099-151963121 GAGCAAGAGCAAAGGAAGGGAGG - Intronic
1017429725 6:154359189-154359211 GAGCAATAACAGATGGAGGCAGG + Intronic
1017645565 6:156537007-156537029 TGGCCAGAGCAGAAGGAGGTAGG + Intergenic
1017919704 6:158860640-158860662 GAGCCTGAGCTGATGGAGACTGG + Intergenic
1017946953 6:159103866-159103888 GATCCAGAAGAGAGGAAGGCGGG - Intergenic
1018059495 6:160079315-160079337 CAGCCAGAGCAGTGGCTGGCTGG + Intronic
1018092710 6:160358836-160358858 CAGTCTGAGCAGAGGGACGCTGG + Intronic
1018573472 6:165234107-165234129 TAGACTGAGCAGAGGGATGCTGG - Intergenic
1018633274 6:165838870-165838892 GGACAAGGGCAGAGGGAGGCTGG - Intronic
1019260824 7:81026-81048 GGGGCTGATCAGAGGGAGGCCGG - Intergenic
1019293643 7:262430-262452 GAGCCACAGCGAAGGGAGGAGGG + Intergenic
1019404727 7:877416-877438 GAGTGAGGGCAGGGGGAGGCCGG - Intronic
1019479416 7:1259749-1259771 GAGTGTGAGCAGAGGGAGGGTGG + Intergenic
1019709927 7:2513559-2513581 GATACAGAGCAGTGGGAGGAGGG - Intronic
1019805054 7:3117575-3117597 GAGAAAGAGGAGAGGGAGGGAGG + Intergenic
1019943980 7:4312209-4312231 GAGCAGAAGCAGAGGGAGGGAGG - Intergenic
1020011490 7:4808002-4808024 GAGGGAGAGGAGAGGGAGGAGGG - Intronic
1020090027 7:5333595-5333617 GATCCAGGACAGAGGGAAGCAGG - Intronic
1020138596 7:5599861-5599883 CACCCACAGGAGAGGGAGGCTGG - Intronic
1020223965 7:6265111-6265133 GAGACAGAGCAGAGTCAGGGAGG + Intronic
1020748658 7:12111729-12111751 GCGTCAGGGCAGAGGGAGGCGGG + Intergenic
1021444684 7:20719660-20719682 GAGCCAGAGCAGGGTGAGGAGGG + Intronic
1021652505 7:22845779-22845801 GAGGCAGAAAAGAGGCAGGCTGG + Intergenic
1021955935 7:25824358-25824380 GAGCCAGGGCAGAGGGGAGATGG - Intergenic
1022427642 7:30284485-30284507 GAGGCGGAGCAGGGGCAGGCAGG + Exonic
1022451580 7:30520807-30520829 CAGCCAGAGTGGAGAGAGGCAGG + Intronic
1022471994 7:30687759-30687781 GAGGGAGGGCAGAGGAAGGCAGG + Intronic
1022520794 7:31005674-31005696 GAAGGAGAGAAGAGGGAGGCAGG + Intergenic
1022528091 7:31051313-31051335 AACCGAGAGCAGAGGCAGGCAGG + Intergenic
1022833782 7:34094463-34094485 GAGCCAGTGAGGAGGCAGGCAGG + Intronic
1023401611 7:39795719-39795741 GAGCCTGAGCAGGGTGAGGTGGG + Intergenic
1023904532 7:44512942-44512964 GAGCCAACGCTGTGGGAGGCCGG - Exonic
1024075592 7:45816341-45816363 GAGCCTGAGCAGGGTGAGGTGGG + Intergenic
1024266433 7:47610389-47610411 GAGCTGGAGCGGAGGGAGCCAGG + Intergenic
1024270138 7:47635767-47635789 GAGAGAGAGGAGAGGGAAGCAGG + Intergenic
1024286059 7:47758635-47758657 GAGACAGAACAGAGAGAGACAGG + Intronic
1024598044 7:50956287-50956309 AAGCCAGAACAGCGGGAGGAGGG - Intergenic
1024648007 7:51384956-51384978 GAGCCTGAGCAGGGTGAGGTGGG - Intergenic
1024676860 7:51645207-51645229 GAGCCTGAGCAGGGTGGGGCTGG - Intergenic
1024942522 7:54777289-54777311 GAGCCAGAGCACAGCCAGTCAGG - Intergenic
1025051861 7:55739452-55739474 GAGCCTGAGCAGGGTGAGGTGGG - Intergenic
1025128819 7:56365120-56365142 GAGCCTGAGCAGGGTGAGGTGGG - Intergenic
1025177200 7:56808001-56808023 GAGCCTGAGCAGGGTGAGGTGGG - Intergenic
1025291731 7:57731914-57731936 GAACCAAAGCAGAGGGAATCGGG - Intergenic
1025694592 7:63768385-63768407 GAGCCTGAGCAGGGTGAGGTGGG + Intergenic
1026545174 7:71316141-71316163 GAGCAGGAGCAAAGGGAGGAAGG + Intronic
1026837689 7:73649340-73649362 GAGCCAGATGAGAGAGAGACAGG - Intergenic
1027744930 7:82061348-82061370 GAGCCAGAGAGGAGTGAGGATGG - Intronic
1028134266 7:87209952-87209974 GAGACAGAGGAGGGGGAGGGGGG + Intronic
1028134274 7:87209984-87210006 GAGACAGAGGAGAGGGAGGGGGG + Intronic
1028378920 7:90176578-90176600 GAGGCAGGGCAGAAAGAGGCAGG - Intronic
1028913191 7:96230361-96230383 GAGCCAGATCAGAAAGAGGATGG - Intronic
1029479085 7:100802209-100802231 CAGCCACTGGAGAGGGAGGCTGG - Intergenic
1030174130 7:106632801-106632823 GGGCCTGATAAGAGGGAGGCCGG - Intergenic
1030270183 7:107661612-107661634 GAGCCAGAGGACAGCGAGGAGGG - Intronic
1030788008 7:113685721-113685743 GAGCCAGCTAAGAGGGAGACTGG - Intergenic
1031443414 7:121821589-121821611 GAGCAAGAGCAGGTGGAGGCAGG - Intergenic
1031586298 7:123534964-123534986 GAGCCAGAGGAGGGGGATGGGGG + Intronic
1031619815 7:123922714-123922736 GAGCAACAGCAGAGGCAGGAAGG - Intergenic
1031824218 7:126542798-126542820 GTGACAGATCAGAGGGAGGATGG + Intronic
1031919042 7:127588297-127588319 GAGCCAGAGCCGGGGGAGGCGGG + Intronic
1032092904 7:128920579-128920601 CAGGCAGAGCAGAAGGAGGTCGG - Intergenic
1032282177 7:130512919-130512941 GAGAAAGAGAAGATGGAGGCTGG + Intronic
1032675869 7:134129273-134129295 GAGACAGAGTGGAGGGAGGGAGG - Intronic
1032738763 7:134717619-134717641 GAGCCTGAGCACAGGGAGGCGGG - Intergenic
1033220321 7:139523361-139523383 GAGCCACAGCAGAGGGTGGTAGG - Intergenic
1033361358 7:140640778-140640800 GAGCCACGGCAGGAGGAGGCAGG - Intronic
1033586095 7:142775452-142775474 TGGACACAGCAGAGGGAGGCAGG + Intergenic
1033586897 7:142780756-142780778 GAGCCAGACCCAAGGGAGGTGGG - Intergenic
1034264537 7:149774473-149774495 AATCCAGAGCTGAGTGAGGCTGG + Intergenic
1034409633 7:150933314-150933336 GAGGCAGGGTAGAGGGAGGTGGG - Intergenic
1034424471 7:151007328-151007350 GAATCAGGGCAGAGTGAGGCAGG - Intronic
1034540556 7:151755383-151755405 GAGCCTGAGCAGAGGAAGACAGG + Intronic
1035023379 7:155811517-155811539 AAGCCAGGGCAGAGGTAGGATGG + Intronic
1035280779 7:157776696-157776718 GAGGCGGAGGAGAGGGAGGCAGG - Intronic
1035420471 7:158725373-158725395 AAGGCAGAGCAGAGGGATGAGGG - Intergenic
1035557959 8:580402-580424 GGGCCGTTGCAGAGGGAGGCAGG - Intergenic
1035587164 8:785559-785581 GGGCCTGAGGGGAGGGAGGCCGG - Intergenic
1036595733 8:10210341-10210363 GAACCAGTGCAGAGAGAGTCAGG - Intronic
1037329017 8:17725391-17725413 GAGCCATACAAGAGTGAGGCTGG - Intronic
1037494758 8:19428031-19428053 GATCCAGAGGAGAAGGAGGAAGG - Intronic
1037496733 8:19447654-19447676 GTCCCAGAGCAGGGGGAGGTGGG + Intronic
1037787740 8:21912513-21912535 GTGCCAGAGGCGTGGGAGGCGGG + Intronic
1037879156 8:22564838-22564860 GACCCATAGCAGAGGCTGGCAGG + Intronic
1037963573 8:23117120-23117142 GGAACACAGCAGAGGGAGGCAGG - Exonic
1038011513 8:23480210-23480232 GAGCCAGAGCTAAGGGAGGGCGG + Intergenic
1038445073 8:27598086-27598108 GATCCAGAGCGGGGAGAGGCTGG + Exonic
1038779477 8:30557762-30557784 AAGGAAGAGCAGTGGGAGGCGGG + Intronic
1039552338 8:38452031-38452053 GAGGGAGAGGGGAGGGAGGCTGG + Intronic
1040436780 8:47398845-47398867 GAGCCAAAGCAAAGGGAGCATGG + Intronic
1040485209 8:47864637-47864659 GTGCCACAGCAGAGTGAGGAGGG + Exonic
1040537585 8:48323336-48323358 GAGACAGGGCAGAGGGTGGAGGG + Intergenic
1040545761 8:48396901-48396923 GACCCAGGGCAGTGGGAGGAAGG - Intergenic
1040889472 8:52301996-52302018 GAGCCAGAGCAGAGTGAAGATGG + Intronic
1040976977 8:53204352-53204374 TGGCGAAAGCAGAGGGAGGCAGG + Intergenic
1041304537 8:56446268-56446290 GAGCGGGAGCCGGGGGAGGCAGG + Intronic
1041347107 8:56910754-56910776 GAGCAAGAGCACAGGGAGGGAGG + Intergenic
1041449956 8:57995146-57995168 GAGCCAGGGCGGGGGGAAGCTGG + Intronic
1042143864 8:65707071-65707093 GCCCCAGTGCAGGGGGAGGCAGG - Exonic
1042693330 8:71528133-71528155 GTGCCAGATCAGAGGCAGCCAGG + Intronic
1044499518 8:92936459-92936481 GAGGATGAACAGAGGGAGGCAGG + Intronic
1044547352 8:93474538-93474560 GAGCCAGAGCTCAGAGTGGCAGG + Intergenic
1047384878 8:124399657-124399679 GAGACACAGAAAAGGGAGGCTGG + Intergenic
1047998521 8:130358405-130358427 CGGCATGAGCAGAGGGAGGCGGG - Intronic
1048284045 8:133127788-133127810 GAGCCAGGGCAGGTGGGGGCTGG - Intronic
1048318624 8:133380947-133380969 GGGCTAGAGCGGAGGGAGGGAGG + Intergenic
1048384650 8:133900901-133900923 GAGCCTAAGCAGAGTGAGGAGGG - Intergenic
1048410102 8:134163584-134163606 GAGCCAGAGGACAGGAAGACCGG + Intergenic
1048471734 8:134710252-134710274 GAGCCAGAGGATAGGAAGGAAGG + Intronic
1048963448 8:139598289-139598311 GAGCTTGAGCAGATGGGGGCAGG - Intergenic
1049062579 8:140287363-140287385 GAGACGAAGCAGAGGGAGGAGGG + Intronic
1049199536 8:141333283-141333305 GAGCCAGAGAAAGGGGCGGCTGG + Intergenic
1049212938 8:141395043-141395065 GAGCCTGAGCAGAGGGTGGAGGG + Intronic
1049250791 8:141588011-141588033 AAGCCAGAGGAGGGGAAGGCAGG + Intergenic
1049303561 8:141884714-141884736 GAGGCAGAGAAGAGGTGGGCGGG - Intergenic
1049395106 8:142396460-142396482 GTTCCAGAGCAGAGTGTGGCAGG - Intronic
1049673776 8:143880787-143880809 GAGACAGGGCAGATGCAGGCAGG + Intergenic
1049804992 8:144534645-144534667 CAGCCAGTGCTGGGGGAGGCAGG + Intronic
1050050445 9:1595684-1595706 AAGCCAGGGCAGAGAGAGACAGG - Intergenic
1052840520 9:33288778-33288800 GAGGCAGAGGAGAGGCAGGGAGG - Intergenic
1053170065 9:35872057-35872079 GAGTCAGGGGAGGGGGAGGCTGG - Intergenic
1053284005 9:36838922-36838944 GAGCCAGGGCAGAGAGAGACTGG - Exonic
1053455642 9:38231336-38231358 GAGGCAGAGCCTAGTGAGGCAGG - Intergenic
1053670705 9:40358836-40358858 GAACCAAAGCAGGGGGAGGTGGG - Intergenic
1054164768 9:61713787-61713809 GAACCAAAGCAGAGGGAATCAGG + Intergenic
1054381826 9:64498898-64498920 GAACCAAAGCAGGGGGAGGTGGG - Intergenic
1054513909 9:66017465-66017487 GAACCAAAGCAGGGGGAGGTGGG + Intergenic
1055381325 9:75710102-75710124 GAGAGAGAGGAGAGGGAGGGAGG - Intergenic
1055778063 9:79787932-79787954 GAGCAAGAGAAGGGGGAGGTGGG - Intergenic
1056595815 9:88006944-88006966 GATGCAGAGCAGGGGAAGGCGGG + Intergenic
1056738018 9:89226195-89226217 GAGACAGGGGACAGGGAGGCTGG - Intergenic
1057151333 9:92798602-92798624 GGGGCAGAGCACAGTGAGGCTGG + Intergenic
1057291698 9:93810887-93810909 GGTCCAGAGCAGGGGCAGGCTGG + Intergenic
1057299739 9:93870932-93870954 GAGCCGGGGGAGAGGGAGCCAGG - Intergenic
1057519763 9:95751729-95751751 GAGCCTGAGCTGCGGGAGGTAGG + Intergenic
1057557618 9:96100301-96100323 GAGGCAGAGCAGAGAAGGGCGGG + Intergenic
1057931312 9:99195955-99195977 GAGGAAGAGCAGAGGGAAGAGGG - Intergenic
1057962516 9:99470190-99470212 GGACCACAGCAGAGGGAGGTGGG + Intergenic
1058924019 9:109643981-109644003 GAGCAAGAGCAAGGGGTGGCGGG + Intronic
1059125253 9:111678572-111678594 GAGCCAGAGTTGATGGAGGTGGG - Intergenic
1059309919 9:113381282-113381304 GAGAGAGAGAAGAGGGAGGGAGG - Intergenic
1059354279 9:113687234-113687256 AAGGCAGAGAAGAGGGAGGAGGG + Intergenic
1059409731 9:114124374-114124396 GAGGCAGAGGAGGGGGAGGAGGG + Intergenic
1059459132 9:114418614-114418636 AGGCCAGAGCAGAGGGAGTACGG - Intronic
1059691145 9:116687313-116687335 GCGCGTGCGCAGAGGGAGGCAGG + Exonic
1060197207 9:121631478-121631500 GGGAGAGAGCAGAGGGAGGTGGG + Intronic
1060215624 9:121736710-121736732 CAGCCAGAGCAGTGGAAGGCAGG - Intronic
1060524568 9:124313243-124313265 GAGCCTGGGCAGAGGAGGGCCGG + Intronic
1060555934 9:124507193-124507215 GAGGCACTGCAGAAGGAGGCTGG + Intronic
1060588221 9:124799878-124799900 GAGCCTGCTCAGAGGGAGGTGGG + Intronic
1060999797 9:127896716-127896738 GAGCCAGAGCAGAGGAGTTCGGG - Intronic
1061105345 9:128525975-128525997 GAGCCAGATCAGTGGGAGTCTGG + Intronic
1061277389 9:129577215-129577237 GAGCCAGTCTAGGGGGAGGCTGG + Intergenic
1061450447 9:130664524-130664546 GAACCAGAGCAGGGGGAGGACGG - Intergenic
1061506074 9:131032454-131032476 GAGCGAGAGCGAAGGGAGGAAGG - Intronic
1061677051 9:132223360-132223382 GGGACAGAGCCGAGGGAGGAGGG + Intronic
1061734556 9:132644968-132644990 GAGCAAAAGCAAAGAGAGGCTGG + Intronic
1061777920 9:132978117-132978139 GAGGCAGCGAGGAGGGAGGCAGG + Intronic
1061916138 9:133755462-133755484 GACCCAGAGGAGAGTGAGGCTGG + Intergenic
1061927915 9:133815189-133815211 GGGCCAGGGAAGAGGGAGGCGGG - Intronic
1062130260 9:134888700-134888722 GAGCCAGGACAGCGGGAAGCAGG + Intergenic
1062153217 9:135032150-135032172 GAGCCAGAGCAGATGCACCCTGG + Intergenic
1062153391 9:135032937-135032959 GAGCCAGAGCAGATGCACCCTGG - Intergenic
1062173341 9:135147586-135147608 GAGCCAGAGGAGGAGGAGGTCGG - Intergenic
1062191352 9:135249465-135249487 TAGGCAGGGCAGAGTGAGGCTGG - Intergenic
1062383572 9:136299254-136299276 GAGCCAGTGCAGATGTGGGCGGG - Intronic
1062403699 9:136383511-136383533 GAGCCAGAGCAGGCGCAGGCCGG - Exonic
1062432978 9:136534194-136534216 GAGCCAAGGCCCAGGGAGGCAGG - Intronic
1062452419 9:136621210-136621232 GAGCCTGCGGAGAGGGCGGCCGG - Intergenic
1062523624 9:136969687-136969709 GAGGCAGGGCAGAGGGAGGCTGG - Intronic
1062697933 9:137884901-137884923 GAGAAACAGAAGAGGGAGGCGGG - Intronic
1203774918 EBV:67562-67584 GTACCAGAGCAGAGGCAGGCAGG - Intergenic
1185616558 X:1425433-1425455 GAGCCTGGGCAGAGCGAGGAAGG - Intronic
1186839547 X:13471423-13471445 GAGCTACAGCAGAGTGAGCCTGG + Intergenic
1188945025 X:36290044-36290066 GAGGAAGAGAAGAGGGAGGGAGG - Intronic
1189175140 X:38949127-38949149 AAGCCAGGGGAGAGGAAGGCAGG + Intergenic
1189294904 X:39911064-39911086 AAGCCAGGGAAGAGGGAGTCAGG - Intergenic
1189426862 X:40909677-40909699 GAGGCAGAAGAGAGGGAGGAGGG + Intergenic
1191849018 X:65571896-65571918 GATTCTGAGCAGAGGGAGGAAGG + Intergenic
1191853176 X:65601402-65601424 GAGTCAGGGGAGAGGGAGGAAGG - Intronic
1192121923 X:68464554-68464576 CAGCCAGATCAGAGTGAGGAGGG + Intergenic
1192204813 X:69088797-69088819 GGGCAAGAGCAGAGGAAGGCTGG + Intergenic
1192226398 X:69231185-69231207 GAGCCAGATCACAGGGTGGCAGG - Intergenic
1192448533 X:71228124-71228146 GAGCCAGAAAGGAGTGAGGCTGG + Intergenic
1192477857 X:71459152-71459174 GCGCCAGGGCCGAGGTAGGCTGG + Intronic
1195013041 X:100752098-100752120 GAGCCCAAGCAGAGTGAGGAAGG + Intergenic
1195141189 X:101961796-101961818 GAGCCAGAGAAGCAGGAGGAAGG + Intergenic
1195708189 X:107753207-107753229 GAGCCAGAGAGGAGAGAGGAGGG + Intronic
1196124282 X:112082691-112082713 GAACAGGAGCAGAGGGAAGCCGG - Exonic
1196743498 X:119046555-119046577 GAGCAAGAAAAGAGAGAGGCCGG - Intergenic
1196858437 X:120005312-120005334 TAGAAAGAGCAGAGGGAGGGGGG - Intergenic
1197655313 X:129110504-129110526 GAGCCAGAGCAAAGGAGGGCAGG + Intergenic
1198040641 X:132848281-132848303 GAGACAGTGCTGAGGAAGGCAGG - Intronic
1200167548 X:154047674-154047696 GAGCAAGAGCAGTGGGAGCCAGG + Intronic
1200214306 X:154360659-154360681 AAGCCAGGGCAAGGGGAGGCAGG - Intronic
1202163791 Y:21965065-21965087 GAGCCATAGCAAAGGGAGTTAGG + Intergenic
1202227565 Y:22621299-22621321 GAGCCATAGCAAAGGGAGTTAGG - Intergenic
1202315559 Y:23574355-23574377 GAGCCATAGCAAAGGGAGTTAGG + Intergenic
1202555209 Y:26095719-26095741 GAGCCATAGCAAAGGGAGTTAGG - Intergenic