ID: 1120793348

View in Genome Browser
Species Human (GRCh38)
Location 14:88606186-88606208
Sequence CTTCATCGAAATTGTAATGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 89
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 84}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120793348_1120793354 23 Left 1120793348 14:88606186-88606208 CCAGCATTACAATTTCGATGAAG 0: 1
1: 0
2: 0
3: 4
4: 84
Right 1120793354 14:88606232-88606254 AGGATAAAAATCTGGCAACAGGG 0: 1
1: 0
2: 1
3: 26
4: 247
1120793348_1120793353 22 Left 1120793348 14:88606186-88606208 CCAGCATTACAATTTCGATGAAG 0: 1
1: 0
2: 0
3: 4
4: 84
Right 1120793353 14:88606231-88606253 CAGGATAAAAATCTGGCAACAGG 0: 1
1: 0
2: 2
3: 5
4: 164
1120793348_1120793352 15 Left 1120793348 14:88606186-88606208 CCAGCATTACAATTTCGATGAAG 0: 1
1: 0
2: 0
3: 4
4: 84
Right 1120793352 14:88606224-88606246 ACTGAAACAGGATAAAAATCTGG 0: 1
1: 0
2: 0
3: 32
4: 339
1120793348_1120793355 24 Left 1120793348 14:88606186-88606208 CCAGCATTACAATTTCGATGAAG 0: 1
1: 0
2: 0
3: 4
4: 84
Right 1120793355 14:88606233-88606255 GGATAAAAATCTGGCAACAGGGG 0: 1
1: 0
2: 2
3: 21
4: 189
1120793348_1120793351 3 Left 1120793348 14:88606186-88606208 CCAGCATTACAATTTCGATGAAG 0: 1
1: 0
2: 0
3: 4
4: 84
Right 1120793351 14:88606212-88606234 GATTTTTGGCTTACTGAAACAGG 0: 1
1: 0
2: 3
3: 12
4: 148

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120793348 Original CRISPR CTTCATCGAAATTGTAATGC TGG (reversed) Intronic
907380705 1:54085205-54085227 CTTCATAGAACCTGTAAAGCAGG + Intronic
908060635 1:60344522-60344544 ATACATATAAATTGTAATGCAGG - Intergenic
908711677 1:67022772-67022794 CTTTATCGTGATTGTAATGGTGG - Intronic
909235605 1:73149079-73149101 CTTGATAGAAATTTTAATGTGGG + Intergenic
919045088 1:192441240-192441262 CTTCATTGAAAATAGAATGCAGG + Intergenic
921107628 1:211998265-211998287 CTTTTTCGAAATTGTTACGCTGG - Intronic
921401208 1:214726117-214726139 ATTCATCAAAATTGAAATGAAGG - Intergenic
924935317 1:248763329-248763351 ATTCACCAAAGTTGTAATGCAGG + Intergenic
1064075324 10:12264267-12264289 CTTCACAGAATTTGTAAGGCTGG + Intergenic
1068334163 10:55609308-55609330 CTTCACACAACTTGTAATGCTGG - Intronic
1071067417 10:81653160-81653182 ATTCACCAAAATTGAAATGCAGG - Intergenic
1072463257 10:95639718-95639740 CTTCAATTAATTTGTAATGCAGG - Intronic
1080724357 11:34880704-34880726 CTTCAAAGTAATTGTCATGCAGG - Intronic
1080912463 11:36616692-36616714 ATTCATGAAATTTGTAATGCTGG - Intronic
1081432159 11:42988268-42988290 CTTCATAGAAATTGAATAGCAGG + Intergenic
1082696515 11:56372711-56372733 CTTCATTGGAATTGCAAGGCAGG - Intergenic
1083239824 11:61379522-61379544 ATTTGTCAAAATTGTAATGCAGG + Intergenic
1085006732 11:73098915-73098937 CTTCATCAAAATTTAAATCCAGG + Intronic
1086758527 11:90596274-90596296 TTTTATAGAAATTATAATGCAGG - Intergenic
1086766266 11:90699160-90699182 CTTCATGGCAATTGTCATGGTGG + Intergenic
1087998054 11:104836580-104836602 CTTAATTGAAATTTTATTGCAGG - Intergenic
1093055340 12:14550369-14550391 CTTCTTGCAAATTGTGATGCAGG - Intronic
1093862473 12:24183052-24183074 CTTGATGCAAATTATAATGCTGG - Intergenic
1095352038 12:41224846-41224868 CTTCATCAGAATTTGAATGCAGG + Intronic
1109332796 13:60951174-60951196 CTTTATCAAAATTGTTTTGCTGG - Intergenic
1109818240 13:67616676-67616698 CTTCAGCAAAATAGAAATGCAGG + Intergenic
1110322237 13:74173616-74173638 CTTCATCCATCTGGTAATGCAGG - Intergenic
1111103827 13:83620613-83620635 TTACATAGAAATTGTAATTCAGG + Intergenic
1114765729 14:25368979-25369001 ATTCACCAAAGTTGTAATGCAGG - Intergenic
1114966591 14:27968886-27968908 ATTCACCGAAGTTGTAATGAAGG + Intergenic
1120793348 14:88606186-88606208 CTTCATCGAAATTGTAATGCTGG - Intronic
1126179286 15:45769065-45769087 CCTGATCAAAGTTGTAATGCTGG - Intergenic
1127486699 15:59424710-59424732 GTTCAGCGAACTTGTGATGCAGG - Intronic
1144329396 17:14210712-14210734 CTTCATGGAACTTATACTGCAGG - Intergenic
1152805704 17:82354929-82354951 CATCATCCAAATTGTAATCATGG - Intergenic
1153524028 18:5978076-5978098 CTTCAGAGGAATTGTACTGCAGG + Intronic
1158474604 18:57768975-57768997 CTTCATGGAAAGTGGAAGGCGGG - Intronic
1164817951 19:31220868-31220890 CTTCATTGAAATTTCAATCCTGG - Intergenic
929583816 2:43101286-43101308 CGCCATGGAAATGGTAATGCGGG + Intergenic
932344220 2:70985210-70985232 CTTCATCGAATGTGTCACGCAGG - Exonic
933160115 2:79014484-79014506 CATAATCGAAATTGTCCTGCAGG + Intergenic
934803647 2:97195115-97195137 CTTCCTCCCAATTGTAATGTGGG - Intronic
934804066 2:97200723-97200745 CTTCCTCCCAATTGTAATGTGGG - Intronic
943905557 2:193496147-193496169 TTTCTTCAAACTTGTAATGCAGG + Intergenic
948261751 2:236609379-236609401 ATTCATTGAAATAATAATGCAGG + Intergenic
1169927800 20:10801395-10801417 CTACATCAAAATAGTAATGTTGG + Intergenic
1174506439 20:51020705-51020727 CTTCATCAACATTGGAAAGCAGG + Intronic
1178302073 21:31461531-31461553 CTTCATCGATAATTGAATGCTGG - Intronic
957354004 3:79058718-79058740 CTTCAAGAAAAGTGTAATGCTGG + Intronic
961158886 3:124705252-124705274 CTTCATTGAAACTATAATGCAGG + Intronic
965410803 3:168328213-168328235 CTTCATCTTAATTCTAATGTGGG + Intergenic
971073085 4:23116748-23116770 TTTTCTCCAAATTGTAATGCAGG - Intergenic
971096099 4:23405364-23405386 CTTCACTGAAATTGTTATGCAGG + Intergenic
974304350 4:60113218-60113240 CTTCAACGAATATGTATTGCTGG + Intergenic
981780762 4:148426789-148426811 CTTCATAGAAATTGCAATTGAGG - Intronic
983436436 4:167721437-167721459 CTTCATCTACATTGTAATTCTGG + Intergenic
984793946 4:183640938-183640960 CTTCAGAGAAATTTAAATGCTGG - Exonic
985838060 5:2284826-2284848 CTTCATCGAGATTCCAAGGCTGG - Intergenic
988292762 5:29310968-29310990 CTTTATCTAAAGTGTAAAGCTGG + Intergenic
990809824 5:59710385-59710407 CTTTATCCAAAATGTAATGTGGG + Intronic
995740316 5:115349083-115349105 CTTTATGGAAAATGTAAGGCAGG + Intergenic
996129383 5:119763086-119763108 ATTCAATAAAATTGTAATGCAGG + Intergenic
996160331 5:120154138-120154160 CCTCCTCTAAATTGTAATGTTGG - Intergenic
1001745762 5:174091143-174091165 CTCCATGGAGATGGTAATGCAGG + Intronic
1006994032 6:38241113-38241135 CTTAATAGAAATTCTGATGCTGG - Intronic
1010915739 6:81616310-81616332 CTTAATCGAAACTGAAATGTTGG - Intronic
1013746094 6:113348133-113348155 CTTCATAGAGAATGTAATCCTGG - Intergenic
1014358896 6:120450039-120450061 ATTCATTGAAAATGAAATGCAGG + Intergenic
1015711429 6:136145668-136145690 CTTCATGAAGATTGTATTGCTGG - Intronic
1016552936 6:145302020-145302042 ATTCATCGAAGTTGAAATGAAGG - Intergenic
1020974932 7:14993488-14993510 TTGCATCAAAATTGTACTGCAGG + Intergenic
1023407768 7:39853996-39854018 CTTCAGAGAAATTTAAATGCTGG - Intergenic
1023729477 7:43176890-43176912 CTGCTTCGTAATTGCAATGCAGG - Intronic
1026183100 7:68059612-68059634 CTTCATCAATATTGTATTCCTGG + Intergenic
1030023849 7:105302563-105302585 CTTCAGAGAAATTTAAATGCTGG + Intronic
1038317610 8:26501097-26501119 CCCCATCAAAATTGTAGTGCAGG - Intronic
1042495249 8:69448297-69448319 CTACATTGAAATCATAATGCTGG + Intergenic
1042898715 8:73699081-73699103 CTTCATTGAAATGGTCATTCAGG - Intronic
1043169739 8:76950586-76950608 CTTTATTCAAATTATAATGCGGG + Intergenic
1046415045 8:113902569-113902591 CTTAAGAGAATTTGTAATGCTGG - Intergenic
1050782316 9:9353029-9353051 ATTCTTCAAAATTTTAATGCAGG + Intronic
1051847811 9:21472220-21472242 CTTCATGAAAATAGAAATGCTGG + Intergenic
1054723168 9:68623866-68623888 ATTCACTGAAATTGGAATGCTGG + Intergenic
1056988223 9:91385402-91385424 GTTCATTTAAATTGTACTGCTGG + Intergenic
1059770690 9:117421540-117421562 CTTCATACAAATTCTAATGCTGG + Intergenic
1195463758 X:105157206-105157228 CCTCATAGAAATTGGAATGGGGG + Intronic
1200508291 Y:4043290-4043312 CTTCATTGAAAATGGAATGAAGG - Intergenic
1200796502 Y:7345887-7345909 CTTCAACGAAAAGGTACTGCAGG - Intergenic
1200852177 Y:7894546-7894568 CTTCATAGAAAATGTTTTGCTGG + Intergenic