ID: 1120793571

View in Genome Browser
Species Human (GRCh38)
Location 14:88607707-88607729
Sequence GATGGGGGATGATACTTGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 142
Summary {0: 1, 1: 9, 2: 1, 3: 7, 4: 124}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120793571 Original CRISPR GATGGGGGATGATACTTGCA GGG (reversed) Intronic
900857456 1:5197419-5197441 GAGGGGGGATGGTACTTATATGG + Intergenic
903402026 1:23060753-23060775 GGTGGTGGATGTTACTTGCTAGG + Intronic
904474890 1:30758353-30758375 GAGGGGGAATGATTCGTGCAAGG + Intergenic
904899077 1:33842069-33842091 GATGGGGGATGAAGTTTGCTTGG - Intronic
916069566 1:161161924-161161946 GTTTGGGGATGAAACATGCATGG + Intronic
916304786 1:163318201-163318223 GATGGGAGATGGTACTGGAAAGG + Intronic
917538552 1:175892102-175892124 GAGAGGGGATGATACTAGGAGGG + Intergenic
918992186 1:191711488-191711510 GATGAGAGATGAGACTGGCAAGG + Intergenic
920304362 1:205009176-205009198 CATGGGGAATCATACTTCCATGG + Intronic
922932262 1:229399386-229399408 GATGTGAGATGATATTTGTAGGG - Intergenic
924189431 1:241534659-241534681 GATGGCGGATGATAATGGCTTGG - Intronic
1064199413 10:13272019-13272041 GGTGGGAGATGATATTTTCATGG - Intergenic
1071832424 10:89384953-89384975 CAGGAGGGATGATACTTTCAGGG - Exonic
1074982167 10:118628333-118628355 GAGGGGGGAGGAACCTTGCAAGG + Intergenic
1079560479 11:21813661-21813683 GATGGGGCATGATATATGGATGG + Intergenic
1084457934 11:69279109-69279131 GATGGTGGATGTTGCATGCATGG - Intergenic
1084457969 11:69279320-69279342 GATGGTGGATGTTGCATGCATGG - Intergenic
1084458006 11:69279532-69279554 GATGGTGGATGCTGCATGCATGG - Intergenic
1084458017 11:69279604-69279626 GATGGTGGATGTTGCATGCATGG - Intergenic
1084458053 11:69279817-69279839 GATGGTGGATGCTGCATGCATGG - Intergenic
1084458072 11:69279959-69279981 GATGGTGGATGCTGCATGCATGG - Intergenic
1084458081 11:69280031-69280053 GATGGTGGATGCTGCATGCATGG - Intergenic
1090418303 11:126556157-126556179 GATTGGGCATGATAGATGCAAGG + Intronic
1091522887 12:1265694-1265716 GGTGGGGCATGATACTTTAAGGG - Intronic
1093006787 12:14059744-14059766 GAGGGGGGGTGAGACATGCAGGG + Intergenic
1093981184 12:25477469-25477491 GATGGAGGATAATAGTTGGAAGG + Intronic
1098324588 12:69288509-69288531 GATGAGGGATGTTACATTCATGG - Intergenic
1098489135 12:71054539-71054561 GATCAGGGATGGTACTTGCCAGG - Intronic
1099828694 12:87812550-87812572 GAAGAAGGAAGATACTTGCAGGG - Intergenic
1103858965 12:123996573-123996595 GATGGGAAAGGATACTTCCACGG + Intronic
1107153418 13:37139138-37139160 GATGGGGGATGAAAATTACTTGG + Intergenic
1110355122 13:74558746-74558768 GATAGGGGATGATTCTTGGGAGG - Intergenic
1113957725 13:114108187-114108209 GATGGGGGATGACAGCTGCGGGG - Intronic
1114429850 14:22651512-22651534 GATGAGGAATGACACTTGGAAGG - Intergenic
1115320419 14:32075142-32075164 GATGCGGAAGGAAACTTGCAAGG - Intergenic
1117684459 14:58239028-58239050 GCTGGGGGATGACACGTGGAGGG + Intronic
1120793509 14:88607418-88607440 GATGGGGGATGGTACTTGCAGGG - Intronic
1120793521 14:88607468-88607490 TGTGGGGGATGGTACTTGCTGGG - Intronic
1120793533 14:88607524-88607546 GAAATGGGATGGTACTTGCAGGG - Intronic
1120793538 14:88607548-88607570 GATGGGGGATGGTACTTGCAGGG - Intronic
1120793571 14:88607707-88607729 GATGGGGGATGATACTTGCAGGG - Intronic
1120793584 14:88607765-88607787 AGTGGGTGATGGTACTTGCAGGG - Intronic
1120793589 14:88607791-88607813 GGTGGGGGATGGTACTTGCAGGG - Intronic
1120793615 14:88607894-88607916 GGTGGGGGATGATACTTGCAGGG - Intronic
1120793622 14:88607920-88607942 GATGGGGGATGGTACTTGCAGGG - Intronic
1120793636 14:88607976-88607998 GATGGGGGATGGTACTTGCAGGG - Intronic
1120793650 14:88608032-88608054 GATGGGGGATGGTACTTGCAAGG - Intronic
1120793656 14:88608058-88608080 GATGGGGGATGGTACTTGCAGGG - Intronic
1120793679 14:88608160-88608182 GATGGGGGATGGTACTTGCAGGG - Intronic
1120793686 14:88608186-88608208 GATGGGGGATGGTACTTGCAGGG - Intronic
1122600775 14:102920640-102920662 GATGAGGGATGATAGATGAATGG - Intergenic
1128098599 15:64978714-64978736 GAAAGGGGATGATACTTTCATGG + Intronic
1130140087 15:81218635-81218657 GCTGGGGGATGATATTTACAAGG - Intronic
1133256975 16:4523020-4523042 GAGGGGGACTGTTACTTGCAAGG + Intronic
1133435407 16:5775261-5775283 GAAGGGGGATGTTAGTTGAAGGG - Intergenic
1134412528 16:14014918-14014940 GTTGGGGGATGAGAATAGCAAGG - Intergenic
1134502579 16:14780763-14780785 GATGGGGACTCATACCTGCATGG - Intronic
1134577984 16:15348132-15348154 GATGGGGACTCATACCTGCATGG + Intergenic
1134724604 16:16409414-16409436 GATGGGGACTCATACCTGCATGG - Intergenic
1134942827 16:18302445-18302467 GATGGGGACTCATACCTGCATGG + Intergenic
1135614781 16:23901793-23901815 GTTGGGGAATGATCATTGCAGGG - Intronic
1138100786 16:54250594-54250616 GATGGAGGATGATAAATGCCAGG + Intronic
1138174066 16:54880239-54880261 GATGGGGGATGAGGCTCACATGG + Intergenic
1138629254 16:58280468-58280490 CATGTTGGATCATACTTGCAGGG - Exonic
1140658551 16:77165191-77165213 GAGGGGAAATGATACTTACAGGG - Intergenic
1140930212 16:79620519-79620541 GATGGGTGAGGATACATTCAGGG - Intergenic
1141030726 16:80585965-80585987 CAGGTGGGATAATACTTGCAAGG + Intergenic
1141612659 16:85191795-85191817 TATGGGAGGTGATACTTGCAAGG + Intergenic
1141719630 16:85749109-85749131 GATGGGGGATTATACTTAGCAGG + Intronic
1142063744 16:88048008-88048030 GATGGGTGATGGGACGTGCAGGG + Intronic
1143034777 17:3988381-3988403 AATGGGGGAAAATCCTTGCAGGG + Intergenic
1147244590 17:39111641-39111663 GATGGTGGAGGCCACTTGCAGGG - Intronic
1147565784 17:41535864-41535886 GCTGGGGGATGGTAGTGGCAGGG - Intergenic
1147931087 17:43981924-43981946 GATGGGAGAAGATATTTGTAAGG - Intronic
1149699854 17:58646370-58646392 GATGTGAGATGAAACTGGCAAGG - Intronic
1153926099 18:9836553-9836575 GATGGAGAATGATTCTTGTAGGG - Intronic
1161142009 19:2653678-2653700 GATGGGGGATGCCCCTGGCATGG - Intronic
1164996884 19:32727385-32727407 AATGGGGGAAAATATTTGCAAGG - Intronic
1166241914 19:41500229-41500251 CATGGGGGATGAGACCTTCAAGG - Intergenic
927871455 2:26626968-26626990 GATGGGGGGATATACATGCAAGG + Intronic
928112470 2:28521910-28521932 GATGGGGGAGGATGCTGGGAAGG - Intronic
931202862 2:60117026-60117048 GATGGGGGATGGTGGTTGGAGGG - Intergenic
931433874 2:62230994-62231016 GATGGGGCAGGAGACTTGCTGGG - Intergenic
944266834 2:197736663-197736685 GATGGGGGAGGATAACTGCCAGG + Intronic
947755928 2:232565196-232565218 GATGGGAGATGAGGCTTGAAAGG - Intronic
1170201980 20:13754136-13754158 GATGGGGGATGAAAGTAGTATGG - Intronic
1170516185 20:17132852-17132874 GGTGGGGGATGATAGTAGCTTGG - Intergenic
1176409002 21:6437605-6437627 GCTGGGGGAGGACACTGGCAGGG - Intergenic
1179684495 21:43045927-43045949 GCTGGGGGAGGACACTGGCAGGG - Intergenic
1184376428 22:44116740-44116762 GATGGGGGATGCTGCCTGGAGGG + Intronic
1185076769 22:48687361-48687383 GATGGTGGATGATGCATGGATGG + Intronic
950996146 3:17499238-17499260 GGTGGAGGATTATACTTGTAAGG + Intronic
951333221 3:21390472-21390494 GATGGAGGATTATACTAGAAAGG - Intergenic
952679651 3:36075593-36075615 GATGGGGAATGAGACTAGCTAGG + Intergenic
953150252 3:40318268-40318290 AAGGGGAGATGATATTTGCAAGG - Intergenic
953547572 3:43874954-43874976 CATAGTGGATGATACTTGAAGGG - Intergenic
957042070 3:75343409-75343431 GGAGGGGGATGCTACTGGCAGGG + Intergenic
958863955 3:99478987-99479009 GATGGGTGATAACACTTCCAAGG - Intergenic
960155472 3:114293524-114293546 CTTGGGGGATGATACATGGATGG - Intronic
966954248 3:184857499-184857521 GTTAAGGGATGATACTTTCAAGG - Intronic
969636167 4:8370521-8370543 GATGGGGGAAGAGGCCTGCAGGG + Intronic
969895577 4:10301452-10301474 GATGGGGTATGGGACTCGCATGG - Intergenic
971150859 4:24029995-24030017 CATGGGGGCTGATTGTTGCACGG - Intergenic
972088370 4:35249155-35249177 GATGGGTGATCAGACTAGCAAGG + Intergenic
979342468 4:119542590-119542612 GATGGAGGAGAATACTGGCAAGG - Exonic
984852500 4:184166709-184166731 GATGGTAGATGATATTTGGAGGG + Intronic
985167786 4:187115892-187115914 GATGAGGGACCATCCTTGCAAGG + Intergenic
991981415 5:72235399-72235421 GATGAGGGATGATACTACAATGG + Intronic
992932960 5:81669655-81669677 GATGGGGGATGAGAGTTGAGGGG + Intronic
997195164 5:131974341-131974363 GTTGGGGAATGAAACTGGCATGG - Intronic
1002851678 6:1002468-1002490 GATGGGGAAGGATACATTCAGGG + Intergenic
1007140766 6:39571274-39571296 GATGAGGGAAGAGACTTGAATGG - Intronic
1007344462 6:41217558-41217580 GATGGGGGATGATAGAGGCATGG + Intergenic
1007345880 6:41229118-41229140 GATGGGGGATGATAGAGGCATGG - Intronic
1008684240 6:53906456-53906478 GATGGGTGGTGAAACTTGCTGGG - Intronic
1010574695 6:77516468-77516490 GATGAGAGATAATAGTTGCATGG - Intergenic
1011998297 6:93621340-93621362 GATAGGGGCTGCTAATTGCAAGG - Intergenic
1013857878 6:114596383-114596405 GATGGGAGATGGTGTTTGCATGG + Intergenic
1014298112 6:119645434-119645456 GGTGGGGGAAAATATTTGCAAGG + Intergenic
1017049533 6:150377408-150377430 GCTGGGGAATGAGACTAGCAGGG - Intronic
1019150233 6:170000646-170000668 GGTGGGGGGTGAGAGTTGCATGG - Intergenic
1020541917 7:9469404-9469426 GTTGGGGGATGAACCTTGTAGGG + Intergenic
1023165581 7:37340297-37340319 GAAGGGGGATGGTGCTTCCAGGG + Intronic
1023340312 7:39212549-39212571 GATGATGGATGGTACTTGGAAGG - Intronic
1023364008 7:39445111-39445133 GATGGATGTTGATAATTGCATGG - Intronic
1024185017 7:46940714-46940736 GACTGGGGATGCTTCTTGCATGG - Intergenic
1026884145 7:73928201-73928223 GATGAGGGATGTTAATAGCAGGG - Intergenic
1029262159 7:99310243-99310265 GGTGGGGGATGAAGCTAGCAGGG + Intergenic
1037696532 8:21228738-21228760 GAGGGGGGCTGTGACTTGCATGG + Intergenic
1038312156 8:26453055-26453077 GCTGGGGGTTGTTACCTGCAAGG - Intronic
1041911838 8:63097349-63097371 CATAGGGGATGATAATTGCATGG + Intergenic
1045717234 8:105062389-105062411 GTTGGGGGATGAAAGTTGAAGGG - Intronic
1062612187 9:137380323-137380345 GGTGGGGGGGGATACTGGCAGGG - Intronic
1187725550 X:22198688-22198710 GATGGGAGATGATAAGTGGAAGG + Intronic
1189677302 X:43474567-43474589 GATGGTGGATGCTAATTCCAGGG - Intergenic
1192078141 X:68021133-68021155 GATAGGAGATGAGACTTGAAAGG - Intergenic
1192330631 X:70172787-70172809 GATGGGAAATGAGACTTTCAAGG + Intergenic
1194268046 X:91779164-91779186 GATGGGGGATGTGAGGTGCAGGG + Intergenic
1194424317 X:93717913-93717935 AATGGGGGAAGGTACTTGGATGG - Intergenic
1195017911 X:100796814-100796836 GATGGGGGATCATACTTTACTGG + Intergenic
1195765514 X:108292754-108292776 GATGGGGGCTGAGACTTTCAGGG - Intronic
1200585249 Y:5000085-5000107 GATGGGGGATGTGAGGTGCAGGG + Intergenic