ID: 1120793589

View in Genome Browser
Species Human (GRCh38)
Location 14:88607791-88607813
Sequence GGTGGGGGATGGTACTTGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 192
Summary {0: 1, 1: 9, 2: 3, 3: 13, 4: 166}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120793589 Original CRISPR GGTGGGGGATGGTACTTGCA GGG (reversed) Intronic
900857456 1:5197419-5197441 GAGGGGGGATGGTACTTATATGG + Intergenic
900864213 1:5255721-5255743 GGTGGGGGATGGCACATGAGTGG + Intergenic
901350091 1:8587705-8587727 GGTGGGGGATAGAACTGGAAAGG - Intronic
902469961 1:16642455-16642477 GGTGAGGGCAGGTACATGCAGGG + Intergenic
903402026 1:23060753-23060775 GGTGGTGGATGTTACTTGCTAGG + Intronic
903917502 1:26774932-26774954 GGTGGGGGCTGGTAGTTAGATGG - Exonic
904468933 1:30723852-30723874 GGTGGGGGGTGGCTCTTCCAGGG + Intergenic
907778445 1:57541981-57542003 GGTGGGGGAGGGTGTGTGCAAGG + Intronic
908761715 1:67518756-67518778 GGTTGGGGATAGTAGTTCCAAGG + Intergenic
913683303 1:121207408-121207430 GGTGGTGGAGGGTGCTGGCAGGG - Intronic
914035144 1:143995032-143995054 GGTGGTGGAGGGTGCTGGCAGGG - Intergenic
914154308 1:145072938-145072960 GGTGGTGGAGGGTGCTGGCAGGG + Intronic
914942989 1:152038861-152038883 GGTGGGGGGTGTTACATGAACGG + Intronic
916304786 1:163318201-163318223 GATGGGAGATGGTACTGGAAAGG + Intronic
916498606 1:165367530-165367552 GGAGGGTAATGGGACTTGCAGGG - Intergenic
919674233 1:200365936-200365958 GGGTGGGGAAGGTACTTCCAGGG - Intergenic
919674252 1:200366029-200366051 GGGTGGGGAAGGTACTTCCAGGG - Intergenic
920659077 1:207899863-207899885 GGTGCAGGCTGGTACTTCCAAGG + Exonic
922219207 1:223544896-223544918 GGAGGGAGATGGTTCTGGCAGGG - Intronic
922307642 1:224357519-224357541 GGCGGGTGTTAGTACTTGCAGGG + Intronic
1064114739 10:12568276-12568298 GGTGGGGGATGGGACGGGAAGGG - Intronic
1064199413 10:13272019-13272041 GGTGGGAGATGATATTTTCATGG - Intergenic
1069341732 10:67417488-67417510 GGTGGGGGAAGGTATTATCAAGG + Intronic
1072965568 10:99969818-99969840 GGTGAGGGATGGTGATGGCATGG - Intronic
1074530582 10:114296077-114296099 GGTGGGTGCTGGTATTTGAATGG - Intronic
1074594378 10:114847728-114847750 GGTGGGGGAGGGAACTTTGAGGG - Intronic
1075219375 10:120571449-120571471 GGAGGGGGAGGGTGCTAGCATGG - Intronic
1077474623 11:2780489-2780511 GGTGGGGGAGGGTGCTGGTAGGG - Intronic
1078573804 11:12482032-12482054 GGTGGTGCATGCTACTTGCGAGG + Intronic
1079922241 11:26447229-26447251 GGTGGGGGGGGGTACTTTTATGG + Intronic
1083450699 11:62743132-62743154 GGTGGTGCATGCTACTTGGAAGG - Intergenic
1087500999 11:98953415-98953437 GGTGGGGAAAGGGACTAGCAGGG - Intergenic
1088194981 11:107264330-107264352 GGTGGAGGATGGGACATGCCTGG + Intergenic
1091522887 12:1265694-1265716 GGTGGGGCATGATACTTTAAGGG - Intronic
1093679251 12:21981890-21981912 GGTGGGGGATGTGTCTTGGAGGG - Intergenic
1094465946 12:30754499-30754521 GGTGGGGGTCGGTGCCTGCAGGG - Exonic
1094617130 12:32046126-32046148 GGTGGAGGATGGGGGTTGCATGG + Intergenic
1096186425 12:49584668-49584690 GGTGTGGGATGGCACTCACATGG - Intronic
1098489135 12:71054539-71054561 GATCAGGGATGGTACTTGCCAGG - Intronic
1099538978 12:83881665-83881687 GGTGGGGGAGGGTAGGTGCAGGG + Intergenic
1100248204 12:92786137-92786159 GGTGTGGGCTGGTAATAGCAAGG - Intronic
1101849477 12:108390807-108390829 GGTGGGGGATGGTACAAACAAGG + Intergenic
1102428155 12:112860877-112860899 GGCGGGGGATGGCAGTTGCATGG - Intronic
1105205030 13:18215670-18215692 GGTGGGGGATGGAACGTTGAAGG - Intergenic
1113966083 13:114154902-114154924 GGTGGGGGATGGGGGATGCAGGG + Intergenic
1115369862 14:32601020-32601042 GGTGGGGGACAGTACTTTAAGGG + Intronic
1115909127 14:38236022-38236044 GGAGGGGGAGGGTAGTTACATGG - Intergenic
1119442021 14:74634863-74634885 GGTGGGGGATGGGAATTTCCAGG + Intergenic
1119485637 14:74984890-74984912 TGTGGGGGAAGGCGCTTGCAGGG + Intergenic
1120680784 14:87478032-87478054 AGTGTTGGTTGGTACTTGCATGG - Intergenic
1120793509 14:88607418-88607440 GATGGGGGATGGTACTTGCAGGG - Intronic
1120793521 14:88607468-88607490 TGTGGGGGATGGTACTTGCTGGG - Intronic
1120793533 14:88607524-88607546 GAAATGGGATGGTACTTGCAGGG - Intronic
1120793538 14:88607548-88607570 GATGGGGGATGGTACTTGCAGGG - Intronic
1120793545 14:88607574-88607596 ATGGGGAGATGGTACTTGCAGGG - Intronic
1120793571 14:88607707-88607729 GATGGGGGATGATACTTGCAGGG - Intronic
1120793584 14:88607765-88607787 AGTGGGTGATGGTACTTGCAGGG - Intronic
1120793589 14:88607791-88607813 GGTGGGGGATGGTACTTGCAGGG - Intronic
1120793609 14:88607869-88607891 AGATGGGGATGGTACTTGCAGGG - Intronic
1120793615 14:88607894-88607916 GGTGGGGGATGATACTTGCAGGG - Intronic
1120793622 14:88607920-88607942 GATGGGGGATGGTACTTGCAGGG - Intronic
1120793636 14:88607976-88607998 GATGGGGGATGGTACTTGCAGGG - Intronic
1120793650 14:88608032-88608054 GATGGGGGATGGTACTTGCAAGG - Intronic
1120793656 14:88608058-88608080 GATGGGGGATGGTACTTGCAGGG - Intronic
1120793679 14:88608160-88608182 GATGGGGGATGGTACTTGCAGGG - Intronic
1120793686 14:88608186-88608208 GATGGGGGATGGTACTTGCAGGG - Intronic
1120851918 14:89179489-89179511 GGAGAGGGATGGTACCTTCAAGG + Intronic
1121033167 14:90676471-90676493 GGTGGTGGGTGGCAGTTGCACGG - Intronic
1122416328 14:101551352-101551374 GGTGGGGGGTGGAGCGTGCAGGG - Intergenic
1123206817 14:106721265-106721287 TGTGGGGGAAGGTGCTTGGAGGG + Intergenic
1123211839 14:106768270-106768292 TGTGGGGGAAGGTGCTTGGAGGG + Intergenic
1125022717 15:35000904-35000926 GGTTGGGGCTGGTACTTAGAAGG - Intergenic
1125556470 15:40589765-40589787 AGTTGAGGATAGTACTTGCAAGG + Intergenic
1125887375 15:43238759-43238781 GGTAGGGGAAGGTTCCTGCAGGG + Intronic
1128669423 15:69563360-69563382 GGTGAGGGTTGGTTGTTGCAGGG + Intergenic
1128825523 15:70712355-70712377 GGTGAGGGATGGTACTAACTTGG - Intronic
1129272077 15:74424270-74424292 GGTGGGTGCTGGTACTTGTTTGG + Intronic
1129356784 15:74996747-74996769 AGAGGGAGATGGTTCTTGCAGGG + Intronic
1130140087 15:81218635-81218657 GCTGGGGGATGATATTTACAAGG - Intronic
1131863473 15:96679927-96679949 GGTGGGGAATGGACCTTGCCTGG - Intergenic
1133755717 16:8761159-8761181 GGTGGGGGAAGCTCCTGGCAGGG - Intronic
1134345665 16:13389015-13389037 GGTGGGGGATGTTAATGACAGGG - Intergenic
1137310919 16:47257460-47257482 GGTGGAGGATACTACTAGCATGG + Intronic
1137621816 16:49881276-49881298 GGAGGGAGATGGGACTTGCCTGG - Intergenic
1139705263 16:68737077-68737099 GGTGGGTTATGGGACCTGCACGG - Intergenic
1142063744 16:88048008-88048030 GATGGGTGATGGGACGTGCAGGG + Intronic
1142290297 16:89191052-89191074 TGTGGGGGGTGGTATGTGCAAGG + Intronic
1146945938 17:36873552-36873574 GGTGGGAGATGGGACTGGAAAGG - Intergenic
1147565784 17:41535864-41535886 GCTGGGGGATGGTAGTGGCAGGG - Intergenic
1147585306 17:41651125-41651147 GGTGGGGGCTGGGCCTGGCAAGG + Intergenic
1148562847 17:48616084-48616106 GGTGGGGGCAGGTGCTTGCCAGG - Intronic
1148625020 17:49062683-49062705 GTTAGGGGATGGGACTTCCAGGG + Intergenic
1149984947 17:61340261-61340283 GGTGGGGGCTGGTGCATACATGG + Intronic
1151348222 17:73516277-73516299 GGTGGGAGATGGTACTGGTCAGG + Intronic
1151880884 17:76893782-76893804 CCTGGGGGATGGGACTTTCAGGG - Intronic
1152380918 17:79941906-79941928 GGTGGGGGAGGGCACGTGCTGGG + Intronic
1153328288 18:3845024-3845046 GGTTGCTTATGGTACTTGCAGGG - Intronic
1157952304 18:52053331-52053353 GGTTGGGGGAGGTATTTGCAAGG - Intergenic
1160234805 18:77077570-77077592 GGTGGGGCAGGGTCCTTGCTTGG + Intronic
1160922706 19:1528425-1528447 GGGCGGGGGTGGTACTTACAGGG - Exonic
1165149774 19:33753742-33753764 GGTGGGGGATGGCAGGTGGATGG - Intronic
925929311 2:8694208-8694230 GGTGGGGGATGGTACGGGGGTGG + Intergenic
926904604 2:17794264-17794286 GGTGGGGGATGGACTTTCCAAGG - Intronic
927464598 2:23327735-23327757 GGTATGGGATGGAAATTGCAGGG - Intergenic
928211621 2:29327998-29328020 GGTGGGGAATGGGACTTGGAAGG + Intronic
928675247 2:33644646-33644668 GGTTGGGGATGGGAGTGGCAGGG - Intergenic
929135502 2:38620043-38620065 GGTGGGGGTAGGTACATGCTTGG - Intergenic
929938396 2:46311743-46311765 GGTGGGGAAAAGTACTTGCTAGG - Intronic
931202862 2:60117026-60117048 GATGGGGGATGGTGGTTGGAGGG - Intergenic
931455606 2:62407712-62407734 GGTGGGGGCTGGAACTTGATGGG - Intergenic
933168158 2:79097101-79097123 GGATGGGGGTGGTCCTTGCAGGG + Intergenic
934139857 2:89035958-89035980 GTTGGGTGTTGGTAATTGCATGG + Intergenic
934229383 2:90164593-90164615 GTTGGGTGTTGGTAATTGCATGG - Intergenic
935127970 2:100240634-100240656 GGTGGAGGATGGGAGGTGCATGG - Intergenic
944336594 2:198541998-198542020 GGTGGGGGATGGAAGGTGTATGG - Intronic
947023145 2:225705958-225705980 AGTGGGGGAGGGTGCTTGAAGGG - Intergenic
948082457 2:235217709-235217731 GGTGGGGGATGGTTCCTACTAGG - Intergenic
948307185 2:236956951-236956973 GGTGGGGGCTGGATCTTGGAGGG + Intergenic
948776014 2:240289362-240289384 AGTGGCGAATGGTACTTGCAGGG - Intergenic
1170516185 20:17132852-17132874 GGTGGGGGATGATAGTAGCTTGG - Intergenic
1170740461 20:19051499-19051521 AGTGGGGGAGGGGACTTCCAGGG + Intergenic
1170881082 20:20296988-20297010 GTTGGGGGATGGTGCTTCAAGGG - Intronic
1171497147 20:25563282-25563304 GGTGGGTAAAGGAACTTGCATGG + Intronic
1174308746 20:49633929-49633951 GGTGGGGGATGGGGGTTGCAGGG + Exonic
1175764030 20:61580888-61580910 GTTGGGGTGTGGGACTTGCAAGG - Intronic
1180760722 22:18201247-18201269 GGTGGGGGATGGAACGTTGAAGG + Intergenic
1180764606 22:18238755-18238777 GGTGGGGGATGGAACGTTGAAGG - Intergenic
1180774946 22:18423449-18423471 GGTGGGGGATGGAACGTTGAAGG - Intergenic
1180808020 22:18734505-18734527 GGTGGGGGATGGAACGTTGAAGG - Intergenic
1180829198 22:18890313-18890335 GGTGGGGGATGGAACGTTGAAGG + Intergenic
1181070947 22:20339470-20339492 GGTGGGGGATGGAACGTTGAAGG - Intergenic
1181215425 22:21324359-21324381 GGTGGGGGATGGAACGTTGAAGG + Intergenic
1184916434 22:47572085-47572107 GGTGGTGACTGGTACTGGCATGG - Intergenic
1185119473 22:48957476-48957498 CGTGGGGGATGCTCCTCGCACGG - Intergenic
1203279290 22_KI270734v1_random:116300-116322 GGTGGGGGATGGAACGTTGAAGG + Intergenic
950426435 3:12927106-12927128 GGTGTGGGCTGGTGCTGGCATGG - Intronic
950485683 3:13272728-13272750 GGAGGGGGATGGAACTTTCCAGG + Intergenic
950996146 3:17499238-17499260 GGTGGAGGATTATACTTGTAAGG + Intronic
953337200 3:42103558-42103580 GGTGGGGGATCGTTCTTGAGTGG + Intronic
953671233 3:44963985-44964007 GCTGGGGGAGGGAACTGGCAGGG - Intronic
954272546 3:49521082-49521104 GGTGTGGAATGGTACTGGCTTGG + Intronic
954299471 3:49691799-49691821 GGTGAGGGCAGGTACATGCAGGG - Intronic
957042070 3:75343409-75343431 GGAGGGGGATGCTACTGGCAGGG + Intergenic
960948403 3:122982677-122982699 GGTGGGGGGTGGTGCATGAAGGG - Intronic
960948873 3:122985743-122985765 GTTGGGGGATGGGATTTGCTTGG - Intronic
963444063 3:145379664-145379686 GGGTGGGGATGGTAGATGCATGG + Intergenic
969895577 4:10301452-10301474 GATGGGGTATGGGACTCGCATGG - Intergenic
972462354 4:39316379-39316401 GCAGGGGGAAGGTTCTTGCATGG - Intronic
974436709 4:61866106-61866128 GGCAGGGGATGGTGCTTGCCTGG - Intronic
981692777 4:147528186-147528208 GGTGAGGTAAGGTACATGCATGG + Intronic
982813430 4:159855293-159855315 GGTGCGGGGTGGAACATGCAAGG + Intergenic
985267081 4:188160366-188160388 GGTGTGGGAGGGTCCTTGCAGGG + Intergenic
986939902 5:12937170-12937192 GGTGGGGAATGGTATATGGATGG + Intergenic
989466954 5:41768271-41768293 TGTGGAGGATTGTTCTTGCAAGG - Intronic
995595534 5:113743806-113743828 GGGGGGAAATGGTGCTTGCATGG + Intergenic
997433091 5:133854820-133854842 GGTGAGAGATGGTGCTGGCAGGG - Intergenic
1003207603 6:4027611-4027633 GGTGGGGGTTGGTCCGTGCTAGG + Intronic
1003393130 6:5730357-5730379 GTTGGGGGAAGGTACTTGGGAGG + Intronic
1006449641 6:34098788-34098810 GGTGGGGGATGTTGCAGGCAAGG - Intronic
1008073527 6:47121325-47121347 GGTGGGGAATAGTAAGTGCAGGG - Intergenic
1013482257 6:110562880-110562902 GGTGGGGGATGGTCTTTGAGGGG - Intergenic
1013857878 6:114596383-114596405 GATGGGAGATGGTGTTTGCATGG + Intergenic
1014298112 6:119645434-119645456 GGTGGGGGAAAATATTTGCAAGG + Intergenic
1015195277 6:130518729-130518751 TTTGGAGGATGGTACTAGCAAGG + Intergenic
1016953971 6:149608682-149608704 GGTGGGGGAGAGAACATGCAGGG - Intronic
1017074935 6:150609307-150609329 GGTGGGGCATTGTATTTGCTTGG + Intronic
1019150233 6:170000646-170000668 GGTGGGGGGTGAGAGTTGCATGG - Intergenic
1023165581 7:37340297-37340319 GAAGGGGGATGGTGCTTCCAGGG + Intronic
1023340312 7:39212549-39212571 GATGATGGATGGTACTTGGAAGG - Intronic
1024229830 7:47355348-47355370 GGTGGGGGACGGTCCTGACAGGG + Intronic
1026186597 7:68086634-68086656 GGTGGGAGGAGGTACTTTCAAGG + Intergenic
1029262159 7:99310243-99310265 GGTGGGGGATGAAGCTAGCAGGG + Intergenic
1029803782 7:102976075-102976097 GGATGGGGGTGGTCCTTGCAGGG - Intronic
1032498112 7:132378042-132378064 GGTGGGTGATGGAACTTCTAGGG - Intronic
1038312156 8:26453055-26453077 GCTGGGGGTTGTTACCTGCAAGG - Intronic
1048206962 8:132423117-132423139 GGTGGGGGGTGGTAATTACATGG - Intronic
1048960638 8:139573878-139573900 GGAGGGGAATGGTACCTGTAAGG + Intergenic
1054936093 9:70689239-70689261 TTTGGGGGGTGGTAATTGCATGG + Intronic
1056665355 9:88577034-88577056 GGTGAGGGAGGGTCCTTGCGAGG + Intronic
1061088441 9:128412528-128412550 GGAGGGGGACGGTTCTTGCAGGG + Intronic
1062060791 9:134494165-134494187 GGTGGTGGATGGTGCTGGGATGG + Intergenic
1062060866 9:134494417-134494439 GGTGGTGGATGGTGCTGGGATGG + Intergenic
1062089449 9:134667489-134667511 GGTGTGGGGTGGTGCTGGCAGGG - Intronic
1062612187 9:137380323-137380345 GGTGGGGGGGGATACTGGCAGGG - Intronic
1187419056 X:19119322-19119344 GGTGGGTGATGGAACTTAAACGG - Intronic
1190254936 X:48755251-48755273 AGTGGGGGATGGAAATTGAATGG - Intergenic
1194424317 X:93717913-93717935 AATGGGGGAAGGTACTTGGATGG - Intergenic
1195392247 X:104374864-104374886 GGTGGGGGCTTGTCCTTCCAAGG + Intergenic
1195671110 X:107470882-107470904 GGTGGGTGGTGGTACCTGGAAGG + Intergenic
1198934873 X:141895210-141895232 GGTGGGGGGTGGTTTTTCCATGG + Intronic
1199873434 X:151915944-151915966 GGTGGGGGATGGGGCGTGGATGG - Intronic
1199874139 X:151918663-151918685 GGTGGGGGATGGGGCGTGGATGG - Intronic