ID: 1120793615

View in Genome Browser
Species Human (GRCh38)
Location 14:88607894-88607916
Sequence GGTGGGGGATGATACTTGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 129
Summary {0: 1, 1: 2, 2: 8, 3: 13, 4: 105}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120793615 Original CRISPR GGTGGGGGATGATACTTGCA GGG (reversed) Intronic
902992570 1:20199484-20199506 GGTGGGGAATGATATGAGCAGGG - Intergenic
903402026 1:23060753-23060775 GGTGGTGGATGTTACTTGCTAGG + Intronic
904129205 1:28263086-28263108 TGCTGGGGATGAGACTTGCAGGG - Intronic
912700976 1:111878081-111878103 GGTGGGGGATGATGTGTGCCTGG + Intronic
913302743 1:117389320-117389342 GGTGGGGGATGATGGCTTCAGGG + Intronic
914942989 1:152038861-152038883 GGTGGGGGGTGTTACATGAACGG + Intronic
916069566 1:161161924-161161946 GTTTGGGGATGAAACATGCATGG + Intronic
924243905 1:242063157-242063179 GGTGGTGGTTCATTCTTGCAGGG + Intergenic
1064199413 10:13272019-13272041 GGTGGGAGATGATATTTTCATGG - Intergenic
1067111734 10:43406230-43406252 GGTGGGGGTAGATGCCTGCAGGG - Intronic
1068640668 10:59402636-59402658 GGTGGGGCCTGATACTTGAGTGG + Intergenic
1075347806 10:121697069-121697091 GGTGGAGGATGATATTACCATGG + Intergenic
1075919473 10:126198384-126198406 TGTGGGTGATGAGACTTGCCGGG - Intronic
1078573804 11:12482032-12482054 GGTGGTGCATGCTACTTGCGAGG + Intronic
1083144495 11:60748575-60748597 GGTGGGGGATGAGACGCACAGGG - Intergenic
1083450699 11:62743132-62743154 GGTGGTGCATGCTACTTGGAAGG - Intergenic
1090389201 11:126376828-126376850 GGTTGGGGATGAGAATTCCATGG + Intronic
1091229270 11:133977303-133977325 GGAGAGGGATGAGACCTGCAAGG + Intergenic
1091522887 12:1265694-1265716 GGTGGGGCATGATACTTTAAGGG - Intronic
1092536437 12:9392498-9392520 GGTGGGGGAAGATTTGTGCAGGG - Intergenic
1092629573 12:10363648-10363670 GGTGGGGGAAGATTTGTGCAGGG - Intergenic
1093679251 12:21981890-21981912 GGTGGGGGATGTGTCTTGGAGGG - Intergenic
1096290320 12:50336741-50336763 AGTGGGGGATGAGACTGGAATGG + Intronic
1099538978 12:83881665-83881687 GGTGGGGGAGGGTAGGTGCAGGG + Intergenic
1101849477 12:108390807-108390829 GGTGGGGGATGGTACAAACAAGG + Intergenic
1102428155 12:112860877-112860899 GGCGGGGGATGGCAGTTGCATGG - Intronic
1117684459 14:58239028-58239050 GCTGGGGGATGACACGTGGAGGG + Intronic
1120793509 14:88607418-88607440 GATGGGGGATGGTACTTGCAGGG - Intronic
1120793521 14:88607468-88607490 TGTGGGGGATGGTACTTGCTGGG - Intronic
1120793538 14:88607548-88607570 GATGGGGGATGGTACTTGCAGGG - Intronic
1120793571 14:88607707-88607729 GATGGGGGATGATACTTGCAGGG - Intronic
1120793584 14:88607765-88607787 AGTGGGTGATGGTACTTGCAGGG - Intronic
1120793589 14:88607791-88607813 GGTGGGGGATGGTACTTGCAGGG - Intronic
1120793609 14:88607869-88607891 AGATGGGGATGGTACTTGCAGGG - Intronic
1120793615 14:88607894-88607916 GGTGGGGGATGATACTTGCAGGG - Intronic
1120793622 14:88607920-88607942 GATGGGGGATGGTACTTGCAGGG - Intronic
1120793636 14:88607976-88607998 GATGGGGGATGGTACTTGCAGGG - Intronic
1120793650 14:88608032-88608054 GATGGGGGATGGTACTTGCAAGG - Intronic
1120793656 14:88608058-88608080 GATGGGGGATGGTACTTGCAGGG - Intronic
1120793663 14:88608084-88608106 AGGGTGAGATGATACTTGCAGGG - Intronic
1120793679 14:88608160-88608182 GATGGGGGATGGTACTTGCAGGG - Intronic
1120793686 14:88608186-88608208 GATGGGGGATGGTACTTGCAGGG - Intronic
1120819270 14:88896914-88896936 GGTGAGGCATGAGACTTGCTCGG + Intergenic
1121786286 14:96663527-96663549 GGTGAGGAATTATACTAGCATGG - Intergenic
1128098599 15:64978714-64978736 GAAAGGGGATGATACTTTCATGG + Intronic
1130140087 15:81218635-81218657 GCTGGGGGATGATATTTACAAGG - Intronic
1133755717 16:8761159-8761181 GGTGGGGGAAGCTCCTGGCAGGG - Intronic
1134236485 16:12470369-12470391 TGTGGGGTCTGATCCTTGCAGGG + Intronic
1134345665 16:13389015-13389037 GGTGGGGGATGTTAATGACAGGG - Intergenic
1134412528 16:14014918-14014940 GTTGGGGGATGAGAATAGCAAGG - Intergenic
1135614781 16:23901793-23901815 GTTGGGGAATGATCATTGCAGGG - Intronic
1137310919 16:47257460-47257482 GGTGGAGGATACTACTAGCATGG + Intronic
1137735310 16:50719396-50719418 GGTGGGGGAAGATCCCAGCAAGG - Intronic
1139749449 16:69100428-69100450 GGATGGGGATGAAACTTGGAGGG + Intergenic
1141612659 16:85191795-85191817 TATGGGAGGTGATACTTGCAAGG + Intergenic
1142070899 16:88090892-88090914 GGTGGGGGAGGAGACATGCTGGG - Intronic
1142803231 17:2358073-2358095 GGTGGCAGGAGATACTTGCAGGG - Intronic
1147565784 17:41535864-41535886 GCTGGGGGATGGTAGTGGCAGGG - Intergenic
1149423139 17:56530215-56530237 GGTTGGGGGTGATGCTTACAAGG - Intergenic
1149549149 17:57527247-57527269 GGTGGGGGATGAGTCCTGCCAGG - Intronic
1150698101 17:67423372-67423394 AGAGGGGGATGATATTTGCCTGG + Intronic
1152252839 17:79220727-79220749 GGTGGGAGATGAGATTTGGAAGG + Intronic
1157028482 18:43875928-43875950 GGTAGGGGATGAAATTTGCCAGG - Intergenic
1160796354 19:947516-947538 GGTGGGGGCTGAGACATGGATGG - Intronic
928211621 2:29327998-29328020 GGTGGGGAATGGGACTTGGAAGG + Intronic
931797912 2:65729377-65729399 AGTGAGGGATGACCCTTGCAAGG - Intergenic
935101143 2:99997462-99997484 GGGGGGGGGTGATAGTTGCTGGG - Intronic
948776014 2:240289362-240289384 AGTGGCGAATGGTACTTGCAGGG - Intergenic
1170516185 20:17132852-17132874 GGTGGGGGATGATAGTAGCTTGG - Intergenic
1171230536 20:23480655-23480677 GGTGGGGGATCAGCCTTGGAGGG + Intergenic
1174308746 20:49633929-49633951 GGTGGGGGATGGGGGTTGCAGGG + Exonic
1176243888 20:64088233-64088255 GGTGGGGCAGGATCCATGCAAGG + Intronic
1176409002 21:6437605-6437627 GCTGGGGGAGGACACTGGCAGGG - Intergenic
1177140999 21:17358071-17358093 TGTAGGTGATAATACTTGCAAGG - Intergenic
1179684495 21:43045927-43045949 GCTGGGGGAGGACACTGGCAGGG - Intergenic
1179771509 21:43621570-43621592 GGAGTGGGATGATATTTTCAAGG + Intronic
1185119473 22:48957476-48957498 CGTGGGGGATGCTCCTCGCACGG - Intergenic
1185191858 22:49443147-49443169 GGTAGGGGGTGATACTTTGAAGG - Intronic
950673338 3:14540111-14540133 GGTGGGGCAGGACACTTGCTGGG - Intronic
950996146 3:17499238-17499260 GGTGGAGGATTATACTTGTAAGG + Intronic
957042070 3:75343409-75343431 GGAGGGGGATGCTACTGGCAGGG + Intergenic
960155472 3:114293524-114293546 CTTGGGGGATGATACATGGATGG - Intronic
960582908 3:119295492-119295514 GGTGGGGGAGGATCCTGGCTGGG + Intronic
964943790 3:162192983-162193005 TGAGGGAGATGATACTTCCATGG - Intergenic
966954248 3:184857499-184857521 GTTAAGGGATGATACTTTCAAGG - Intronic
974868091 4:67604414-67604436 GGTGGGGGCTGATAGCTGGAGGG + Intronic
979707592 4:123739133-123739155 GGTGTGGGAAAATACATGCAAGG - Intergenic
982377696 4:154712364-154712386 GGTTGGGGATGAGAATGGCAGGG - Intronic
983167345 4:164494251-164494273 GGTGGGAGTTAACACTTGCAAGG - Intergenic
984509190 4:180658052-180658074 AGTGGGCGAAGATACTTGGAAGG - Intergenic
985267081 4:188160366-188160388 GGTGTGGGAGGGTCCTTGCAGGG + Intergenic
990247104 5:53874014-53874036 GGTGAGGGATGATGGTTTCAGGG + Intergenic
993102040 5:83552310-83552332 GGTGGGGGGAGATACTTACTAGG + Intronic
994890560 5:105628944-105628966 AGTGGAGGATGATACTATCAAGG - Intergenic
997195164 5:131974341-131974363 GTTGGGGAATGAAACTGGCATGG - Intronic
998738528 5:145171474-145171496 GGTGGACAATGATGCTTGCAGGG - Intergenic
999120029 5:149202038-149202060 AGTGAGGGATGATATTGGCATGG + Intronic
1000386068 5:160675800-160675822 GGAGGTGGATTAGACTTGCAGGG + Intronic
1001040692 5:168333041-168333063 GGTGGGGCTTGAGACTTGAAGGG - Intronic
1002320891 5:178375275-178375297 GGTGGGGGATAATAGCTACAGGG + Intronic
1003703892 6:8501500-8501522 GGCTGGAGATGATACTTCCAAGG - Intergenic
1006449641 6:34098788-34098810 GGTGGGGGATGTTGCAGGCAAGG - Intronic
1007344462 6:41217558-41217580 GATGGGGGATGATAGAGGCATGG + Intergenic
1007345880 6:41229118-41229140 GATGGGGGATGATAGAGGCATGG - Intronic
1014298112 6:119645434-119645456 GGTGGGGGAAAATATTTGCAAGG + Intergenic
1017049533 6:150377408-150377430 GCTGGGGAATGAGACTAGCAGGG - Intronic
1019150233 6:170000646-170000668 GGTGGGGGGTGAGAGTTGCATGG - Intergenic
1019830350 7:3322122-3322144 GGTGGGGGATGAAACTGTCCCGG - Intronic
1020541917 7:9469404-9469426 GTTGGGGGATGAACCTTGTAGGG + Intergenic
1029262159 7:99310243-99310265 GGTGGGGGATGAAGCTAGCAGGG + Intergenic
1029715720 7:102324424-102324446 GGTGGGATATGAGACCTGCAAGG + Intergenic
1030849931 7:114471365-114471387 GGTGGGAAATGATACCTGAATGG - Intronic
1034834077 7:154336001-154336023 GGTGGTGGATGAGACCTGCCTGG - Intronic
1038312156 8:26453055-26453077 GCTGGGGGTTGTTACCTGCAAGG - Intronic
1039453761 8:37695414-37695436 GGTGGGGGGTGATGCTGGCGGGG - Intergenic
1041911838 8:63097349-63097371 CATAGGGGATGATAATTGCATGG + Intergenic
1045717234 8:105062389-105062411 GTTGGGGGATGAAAGTTGAAGGG - Intronic
1048206962 8:132423117-132423139 GGTGGGGGGTGGTAATTACATGG - Intronic
1050028835 9:1364194-1364216 GGTTGGGGATAACACTCGCATGG - Intergenic
1052208438 9:25871351-25871373 GGTGGGAGATGATTGATGCAAGG - Intergenic
1052565234 9:30141175-30141197 GGTGGGAGATGATTCATTCATGG - Intergenic
1055517499 9:77047984-77048006 GGTTTGAGATGAAACTTGCACGG - Intergenic
1061088441 9:128412528-128412550 GGAGGGGGACGGTTCTTGCAGGG + Intronic
1062612187 9:137380323-137380345 GGTGGGGGGGGATACTGGCAGGG - Intronic
1186728439 X:12382331-12382353 AGAGGGGTATGATACTGGCAGGG + Intronic
1186763573 X:12748095-12748117 GGTGGGAGGTGAGAATTGCAGGG - Intergenic
1192156981 X:68753963-68753985 GGTGAGAGATGATATTAGCAAGG - Intergenic
1195765514 X:108292754-108292776 GATGGGGGCTGAGACTTTCAGGG - Intronic
1196672131 X:118379889-118379911 GGTGGGGGATGAGAAGTGGAAGG - Intronic